WormBase Tree Display for Variation: WBVar00143022
expand all nodes | collapse all nodes | view schema
WBVar00143022 | Evidence | Paper_evidence | WBPaper00027121 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e188 | |||||
Other_name | e188ts | ||||||
H27M09.4.1:c.415G>C | |||||||
CE25036:p.Gly139Arg | |||||||
HGVSg | CHROMOSOME_I:g.6844486G>C | ||||||
Sequence_details | SMap | S_parent | Sequence | H27M09 | |||
Flanking_sequences | acatgccaacaaggaaaggctggaccacca | gaccaccaggagatgatggaaaggacggaa | |||||
Mapping_target | H27M09 | ||||||
Type_of_mutation | Substitution | g | c | Paper_evidence | WBPaper00027121 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain (62) | |||||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00001075 | |||||
Transcript | H27M09.4.1 (12) | ||||||
Interactor | WBInteraction000518462 | ||||||
Genetics | Interpolated_map_position | I | 1.37773 | ||||
Mapping_data | In_2_point | 5 | |||||
241 | |||||||
242 | |||||||
5116 | |||||||
5118 | |||||||
6055 | |||||||
In_multi_point | 12 | ||||||
231 | |||||||
236 | |||||||
237 | |||||||
241 | |||||||
242 | |||||||
243 | |||||||
244 | |||||||
248 | |||||||
250 | |||||||
251 | |||||||
279 | |||||||
283 | |||||||
290 | |||||||
345 | |||||||
346 | |||||||
431 | |||||||
432 | |||||||
433 | |||||||
435 | |||||||
438 | |||||||
439 | |||||||
443 | |||||||
446 | |||||||
447 | |||||||
449 | |||||||
450 | |||||||
710 | |||||||
814 | |||||||
1223 | |||||||
1232 | |||||||
1235 | |||||||
1274 | |||||||
1460 | |||||||
1461 | |||||||
1462 | |||||||
1463 | |||||||
1464 | |||||||
1465 | |||||||
1466 | |||||||
1694 | |||||||
1784 | |||||||
1889 | |||||||
1890 | |||||||
1892 | |||||||
2000 | |||||||
2089 | |||||||
2140 | |||||||
2141 | |||||||
2142 | |||||||
2143 | |||||||
2144 | |||||||
2145 | |||||||
2146 | |||||||
2147 | |||||||
2148 | |||||||
2149 | |||||||
2150 | |||||||
2281 | |||||||
2282 | |||||||
2459 | |||||||
2468 | |||||||
3004 | |||||||
3005 | |||||||
3196 | |||||||
3513 | |||||||
In_pos_neg_data (55) | |||||||
Description (2) | |||||||
Reference | WBPaper00001328 | ||||||
WBPaper00000031 | |||||||
WBPaper00004883 | |||||||
WBPaper00024024 | |||||||
WBPaper00014397 | |||||||
WBPaper00016102 | |||||||
WBPaper00025792 | |||||||
WBPaper00033444 | |||||||
WBPaper00061175 | |||||||
Remark | Created by WBPerson51134 from the NN_VFP_triage_pipeline | ||||||
Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||||
Method | Substitution_allele |