WormBase Tree Display for Variation: WBVar00143061
expand all nodes | collapse all nodes | view schema
| WBVar00143061 | Evidence | Paper_evidence | WBPaper00004985 | ||
|---|---|---|---|---|---|
| Name | Public_name | e245 | |||
| Other_name | ZC416.8a.1:c.1039G>C | ||||
| ZC416.8b.1:c.1-1285G>C | |||||
| CE17307:p.Gly347Arg | |||||
| HGVSg | CHROMOSOME_IV:g.3619060C>G | ||||
| Sequence_details | SMap | S_parent | Sequence | ZC416 | |
| Flanking_sequences | gcgattgctatggttgggttggctatggag | gaatcgcgtgttttgcaatcccctatacca | |||
| Mapping_target | ZC416 | ||||
| Type_of_mutation | Substitution | g | m | ||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain (17) | |||||
| Laboratory | CB | ||||
| Status | Live | ||||
| Affects | Gene | WBGene00006756 | |||
| WBGene00000481 | |||||
| Transcript | ZC416.8a.1 (12) | ||||
| ZC416.8b.1 | VEP_consequence | intron_variant | |||
| VEP_impact | MODIFIER | ||||
| HGVSc | ZC416.8b.1:c.1-1285G>C | ||||
| Intron_number | 1/11 | ||||
| Interactor | WBInteraction000518365 | ||||
| WBInteraction000518556 | |||||
| WBInteraction000518559 | |||||
| WBInteraction000518561 | |||||
| WBInteraction000518851 | |||||
| WBInteraction000518855 | |||||
| WBInteraction000519040 | |||||
| WBInteraction000519045 | |||||
| WBInteraction000519046 | |||||
| Genetics | Interpolated_map_position | IV | -3.11559 | ||
| Mapping_data | In_2_point | 103 | |||
| 728 | |||||
| 1646 | |||||
| 1647 | |||||
| 2757 | |||||
| In_multi_point | 96 | ||||
| 101 | |||||
| 104 | |||||
| 275 | |||||
| 455 | |||||
| 456 | |||||
| 457 | |||||
| 458 | |||||
| 459 | |||||
| 460 | |||||
| 461 | |||||
| 462 | |||||
| 463 | |||||
| 464 | |||||
| 465 | |||||
| 466 | |||||
| 596 | |||||
| 610 | |||||
| 623 | |||||
| 684 | |||||
| 691 | |||||
| 742 | |||||
| 900 | |||||
| 901 | |||||
| 904 | |||||
| 1127 | |||||
| 1132 | |||||
| 1517 | |||||
| 1523 | |||||
| 3063 | |||||
| 3132 | |||||
| 5675 | |||||
| Description (2) | |||||
| Reference (22) | |||||
| Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006756 Missense 347 G to R | ||||
| Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00000481 Intron Inferred_automatically map_Alleles.pl | |||||
| Method | Substitution_allele |
