WormBase Tree Display for Variation: WBVar00143063
expand all nodes | collapse all nodes | view schema
WBVar00143063 | Evidence | Paper_evidence | WBPaper00031175 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e251 | |||||
Other_name | CE24860:p.Trp452Ter | ||||||
C50C3.9c.1:c.1355G>A | |||||||
CE32168:p.Trp496Ter | |||||||
C50C3.9a.1:c.1487G>A | |||||||
HGVSg | CHROMOSOME_III:g.8197512C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | C50C3 | |||
Flanking_sequences | cattataaagaatctggacaattatcttggt | gactggagtttacagagaaagattggtgagt | |||||
Mapping_target | C50C3 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00031175 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain (67) | |||||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006772 | |||||
Transcript (2) | |||||||
Interactor | WBInteraction000052098 | ||||||
WBInteraction000052102 | |||||||
WBInteraction000502423 | |||||||
WBInteraction000502424 | |||||||
Genetics | Interpolated_map_position | III | -0.373497 | ||||
Mapping_data | In_2_point (12) | ||||||
In_multi_point | 76 | ||||||
368 | |||||||
369 | |||||||
370 | |||||||
376 | |||||||
377 | |||||||
378 | |||||||
379 | |||||||
389 | |||||||
406 | |||||||
409 | |||||||
412 | |||||||
428 | |||||||
429 | |||||||
430 | |||||||
559 | |||||||
756 | |||||||
872 | |||||||
874 | |||||||
877 | |||||||
878 | |||||||
1093 | |||||||
1100 | |||||||
1101 | |||||||
1109 | |||||||
1110 | |||||||
1113 | |||||||
1397 | |||||||
1403 | |||||||
1405 | |||||||
1406 | |||||||
1407 | |||||||
1410 | |||||||
1411 | |||||||
1413 | |||||||
1417 | |||||||
1419 | |||||||
1484 | |||||||
1486 | |||||||
1494 | |||||||
1623 | |||||||
1624 | |||||||
1634 | |||||||
1639 | |||||||
1662 | |||||||
1667 | |||||||
1753 | |||||||
1755 | |||||||
1886 | |||||||
1903 | |||||||
1904 | |||||||
1907 | |||||||
2056 | |||||||
2104 | |||||||
2130 | |||||||
2178 | |||||||
2180 | |||||||
2181 | |||||||
2182 | |||||||
2186 | |||||||
2187 | |||||||
2188 | |||||||
2189 | |||||||
2217 | |||||||
2242 | |||||||
2243 | |||||||
2247 | |||||||
2743 | |||||||
2761 | |||||||
3167 | |||||||
3168 | |||||||
3169 | |||||||
3170 | |||||||
3175 | |||||||
3178 | |||||||
3191 | |||||||
3192 | |||||||
3297 | |||||||
3298 | |||||||
3299 | |||||||
3300 | |||||||
3301 | |||||||
3302 | |||||||
3305 | |||||||
3306 | |||||||
3387 | |||||||
In_pos_neg_data | 807 | ||||||
818 | |||||||
1617 | |||||||
3807 | |||||||
Description | Phenotype (20) | ||||||
Phenotype_not_observed (5) | |||||||
Reference (30) | |||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006772 Amber_UAG_or_Opal_UGA | ||||||
Method | Substitution_allele |