WormBase Tree Display for Variation: WBVar00094697
expand all nodes | collapse all nodes | view schema
| WBVar00094697 | Evidence | Paper_evidence | WBPaper00030897 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | or195 | |||||||
| Other_name | or195ts | ||||||||
| T21E12.4b.1:c.6803C>T | |||||||||
| CE23997:p.Ser3200Leu | |||||||||
| CE51690:p.Ser2268Leu | |||||||||
| T21E12.4a.1:c.9599C>T | |||||||||
| HGVSg | CHROMOSOME_I:g.4397405C>T | ||||||||
| Sequence_details | SMap | S_parent | Sequence | T21E12 | |||||
| Flanking_sequences | aacagaaggctgaagaagagaagaagttct | ggagcaattgcagaaggagctcgcagagca | |||||||
| Mapping_target | T21E12 | ||||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00030897 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00007309 | ||||||||
| Laboratory | EU | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00000962 | |||||||
| Transcript | T21E12.4a.1 | VEP_consequence | missense_variant | ||||||
| VEP_impact | MODERATE | ||||||||
| HGVSc | T21E12.4a.1:c.9599C>T | ||||||||
| HGVSp | CE23997:p.Ser3200Leu | ||||||||
| cDNA_position | 9604 | ||||||||
| CDS_position | 9599 | ||||||||
| Protein_position | 3200 | ||||||||
| Exon_number | 11/17 | ||||||||
| Codon_change | tCg/tTg | ||||||||
| Amino_acid_change | S/L | ||||||||
| T21E12.4b.1 | VEP_consequence | missense_variant | |||||||
| VEP_impact | MODERATE | ||||||||
| HGVSc | T21E12.4b.1:c.6803C>T | ||||||||
| HGVSp | CE51690:p.Ser2268Leu | ||||||||
| cDNA_position | 6803 | ||||||||
| CDS_position | 6803 | ||||||||
| Protein_position | 2268 | ||||||||
| Exon_number | 7/12 | ||||||||
| Codon_change | tCg/tTg | ||||||||
| Amino_acid_change | S/L | ||||||||
| Interactor | WBInteraction000008081 | ||||||||
| WBInteraction000008086 | |||||||||
| WBInteraction000008089 | |||||||||
| WBInteraction000008093 | |||||||||
| WBInteraction000008098 | |||||||||
| WBInteraction000008102 | |||||||||
| WBInteraction000008107 | |||||||||
| WBInteraction000008110 | |||||||||
| WBInteraction000008113 | |||||||||
| WBInteraction000008116 | |||||||||
| WBInteraction000008121 | |||||||||
| WBInteraction000008125 | |||||||||
| WBInteraction000008129 | |||||||||
| WBInteraction000008133 | |||||||||
| WBInteraction000008137 | |||||||||
| WBInteraction000008141 | |||||||||
| WBInteraction000008145 | |||||||||
| WBInteraction000008150 | |||||||||
| WBInteraction000008153 | |||||||||
| WBInteraction000008156 | |||||||||
| WBInteraction000008159 | |||||||||
| WBInteraction000008164 | |||||||||
| WBInteraction000008168 | |||||||||
| WBInteraction000008172 | |||||||||
| WBInteraction000008175 | |||||||||
| WBInteraction000008179 | |||||||||
| WBInteraction000008182 | |||||||||
| WBInteraction000008186 | |||||||||
| WBInteraction000008189 | |||||||||
| WBInteraction000008191 | |||||||||
| WBInteraction000008193 | |||||||||
| WBInteraction000008196 | |||||||||
| WBInteraction000008199 | |||||||||
| WBInteraction000008202 | |||||||||
| WBInteraction000008205 | |||||||||
| WBInteraction000008208 | |||||||||
| WBInteraction000008212 | |||||||||
| WBInteraction000008215 | |||||||||
| WBInteraction000008218 | |||||||||
| WBInteraction000008220 | |||||||||
| WBInteraction000008223 | |||||||||
| WBInteraction000008226 | |||||||||
| WBInteraction000008229 | |||||||||
| WBInteraction000008233 | |||||||||
| WBInteraction000008234 | |||||||||
| WBInteraction000008238 | |||||||||
| WBInteraction000008240 | |||||||||
| WBInteraction000008242 | |||||||||
| WBInteraction000008243 | |||||||||
| WBInteraction000008246 | |||||||||
| WBInteraction000008249 | |||||||||
| WBInteraction000008252 | |||||||||
| WBInteraction000008255 | |||||||||
| WBInteraction000008258 | |||||||||
| WBInteraction000502995 | |||||||||
| WBInteraction000502996 | |||||||||
| Isolation | Forward_genetics | Standard phenotypic screen | Person_evidence | WBPerson3760 | |||||
| Genetics | Interpolated_map_position | I | -1.31005 | ||||||
| Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00030897 | |||||
| WBPaper00032264 | |||||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPerson2021 | |||||||||
| Remark | When shifted to restrictive temperatures, hermaphrodites produce dead embryos | Paper_evidence | WBPaper00032264 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Recessive | Paper_evidence | WBPaper00030897 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00030897 | ||||
| WBPaper00032264 | |||||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPerson2021 | |||||||||
| Temperature_sensitive | Heat_sensitive | 23 | Paper_evidence | WBPaper00030897 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| 25C | Paper_evidence | WBPaper00032264 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | L1 larvae were grown on L4440 control dsRNA-expressing bacterial strains at different temperatures. | Paper_evidence | WBPaper00030897 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000961 | Paper_evidence | WBPaper00030897 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | DYRB-1::GFP and DYLT-1::GFP localize to centrosomes and mitotic spindle poles in embryos from homozygous dhc-1 mutant worms. Localization is faint in embryos from WT. | Paper_evidence | WBPaper00030897 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| DYRB-1::GFP and DYLT-1::GFP localize to centrosomes and mitotic spindle poles in embryos from heterozygous dhc-1 mutant worms. Signal is weaker than in embryos from dhc-1 homozygous worms shifted to 26C. No signal was seen in embryos from dhc-1 RNAi treated worms. | Paper_evidence | WBPaper00030897 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00030897 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00030897 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Treatment | Worms were shifted to 26C for 3 hrs (DYRB-1) or 5 hrs (DYLT-1) before embryos were viewed. | Paper_evidence | WBPaper00030897 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Heterozygous dhc-1 worms were grown at 15C. | Paper_evidence | WBPaper00030897 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Temperature | 26C | Paper_evidence | WBPaper00030897 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| 15C | Paper_evidence | WBPaper00030897 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001102 | Paper_evidence | WBPaper00030897 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | P0 spindles are 30% length of WT spindles | Paper_evidence | WBPaper00030897 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00030897 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Treatment | Time-lapse video was used to monitor the first cell divisions in embryos from adults that were shifted from 23C to 26C for 3-5 hrs. | Paper_evidence | WBPaper00030897 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Temperature | 26C | Paper_evidence | WBPaper00030897 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001130 | Paper_evidence | WBPaper00030897 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Penetrance | Incomplete | 89% | Paper_evidence | WBPaper00030897 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00030897 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Treatment | Time-lapse video was used to monitor the first cell divisions in embryos from adults that were shifted from 23C to 26C for 3-5 hrs. | Paper_evidence | WBPaper00030897 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_not_observed | WBPhenotype:0000436 | Paper_evidence | WBPaper00028886 | ||||||
| Curator_confirmed | WBPerson48 | ||||||||
| Remark | Localization of the synaptic protein SNB-1 is normal, based on expression analysis with SNB-1::VENUS. | Paper_evidence | WBPaper00028886 | ||||||
| Curator_confirmed | WBPerson48 | ||||||||
| WBPhenotype:0000679 | Paper_evidence | WBPaper00028448 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | PKD-2::GFP localization is not different from wild type. | Paper_evidence | WBPaper00028448 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000962 | Paper_evidence | WBPaper00030801 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Similar to the wild-type background, Ubi-1::PKD-2::GFP levels are greatly reduced in mutant males (data not shown). | Paper_evidence | WBPaper00030801 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference | WBPaper00028886 | ||||||||
| WBPaper00032264 | |||||||||
| WBPaper00028448 | |||||||||
| WBPaper00030897 | |||||||||
| WBPaper00030801 | |||||||||
| Remark | Allele was previously curated as an H(2157) to L mutation. | Paper_evidence | WBPaper00025116 | ||||||
| Method | Substitution_allele |
