WormBase Tree Display for Variation: WBVar00241365
expand all nodes | collapse all nodes | view schema
WBVar00241365 | Name | Public_name | r459 | ||||
---|---|---|---|---|---|---|---|
Other_name | CE33137:p.Asp189Asn | ||||||
K04F10.6a.1:c.565G>A | |||||||
K04F10.6b.3:c.565G>A | |||||||
K04F10.6b.1:c.565G>A | |||||||
CE11740:p.Asp189Asn | |||||||
K04F10.6b.2:c.565G>A | |||||||
HGVSg | CHROMOSOME_I:g.6357738C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | K04F10 | |||
Flanking_sequences | aaagtgatgacggtagacggaatcgattgt | atatcagtgtagttatggatcgatttctgt | |||||
Mapping_target | K04F10 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00024972 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain (21) | |||||||
Laboratory | TR | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00003499 | |||||
Transcript | K04F10.6b.3 | VEP_consequence | missense_variant | ||||
VEP_impact | MODERATE | ||||||
SIFT | 0 | deleterious | |||||
PolyPhen | 1 | probably_damaging | |||||
HGVSc | K04F10.6b.3:c.565G>A | ||||||
HGVSp | CE33137:p.Asp189Asn | ||||||
cDNA_position | 580 | ||||||
CDS_position | 565 | ||||||
Protein_position | 189 | ||||||
Exon_number | 4/8 | ||||||
Codon_change | Gat/Aat | ||||||
Amino_acid_change | D/N | ||||||
K04F10.6b.1 (12) | |||||||
K04F10.6a.1 (12) | |||||||
K04F10.6b.2 (12) | |||||||
Genetics | Interpolated_map_position | I | 1.06202 | ||||
Description | Phenotype (3) | ||||||
Phenotype_not_observed | WBPhenotype:0000679 | Paper_evidence | WBPaper00035228 | ||||
Curator_confirmed | WBPerson712 | ||||||
Remark | PGL-1 staining in the germline resembles wild type and appear associated with nuclei periphery. | Paper_evidence | WBPaper00035228 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference (31) | |||||||
Method | Substitution_allele |