WormBase Tree Display for Variation: WBVar00088765
expand all nodes | collapse all nodes | view schema
WBVar00088765 | Evidence | Paper_evidence | WBPaper00004705 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ma116 | ||||||
Other_name | F46B6.3b.1:c.141-1G>A | |||||||
F46B6.3a.1:c.141-1G>A | ||||||||
HGVSg | CHROMOSOME_V:g.9777550C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | F46B6 | ||||
Flanking_sequences | tttgcttctaaagtcataaacattttttca | gttcgaccgatgtgcttatgcaacgcttac | ||||||
Mapping_target | F46B6 | |||||||
Type_of_mutation | Substitution | G | A | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004551 | |||||||
WBStrain00004567 | ||||||||
Laboratory | VT | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00004882 | ||||||
Transcript | F46B6.3b.1 | VEP_consequence | splice_acceptor_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F46B6.3b.1:c.141-1G>A | |||||||
Intron_number | 2/5 | |||||||
F46B6.3a.1 | VEP_consequence | splice_acceptor_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F46B6.3a.1:c.141-1G>A | |||||||
Intron_number | 2/5 | |||||||
Interactor | WBInteraction000517351 | |||||||
WBInteraction000517352 | ||||||||
WBInteraction000517353 | ||||||||
WBInteraction000517354 | ||||||||
WBInteraction000518885 | ||||||||
WBInteraction000518890 | ||||||||
Genetics | Interpolated_map_position | V | 2.19428 | |||||
Mapping_data | In_2_point | 3387 | ||||||
In_multi_point | 1192 | |||||||
3101 | ||||||||
3102 | ||||||||
In_pos_neg_data | 4574 | |||||||
4575 | ||||||||
Description | Phenotype (3) | |||||||
Phenotype_not_observed | WBPhenotype:0001828 | Paper_evidence | WBPaper00004325 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutant smg-3 and smg-4 animals gave a weak, variable response, suggesting that smg-3 or smg-4 may not be required for persistence of RNAi | Paper_evidence | WBPaper00004325 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | RNAi injection | Paper_evidence | WBPaper00004325 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00013705 | |||||||
WBPaper00004325 | ||||||||
WBPaper00001192 | ||||||||
WBPaper00021643 | ||||||||
WBPaper00001813 | ||||||||
WBPaper00022962 | ||||||||
WBPaper00017298 | ||||||||
Remark | Substitution is at the end of the first intron [030411 ck1] | |||||||
Method | Substitution_allele |