WormBase Tree Display for Variation: WBVar00088915
expand all nodes | collapse all nodes | view schema
WBVar00088915 | Evidence | Paper_evidence | WBPaper00004727 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | mg158 | |||||||
Other_name | C40H5.5a.1:c.1018T>A | ||||||||
CE43132:p.Phe312Ile | |||||||||
CE27107:p.Phe340Ile | |||||||||
C40H5.5b.1:c.934T>A | |||||||||
HGVSg | CHROMOSOME_X:g.11764947A>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | C40H5 | |||||
Flanking_sequences | ctcgacggtattttgcacgagcattttgaa | ccaaacctggaaacaaaagtagttctggat | |||||||
Mapping_target | C40H5 | ||||||||
Type_of_mutation | Substitution | a | t | Curator_confirmed | WBPerson4055 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00029272 | ||||||||
WBStrain00029472 | |||||||||
WBStrain00029473 | |||||||||
WBStrain00029474 | |||||||||
Laboratory | GR | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006654 | |||||||
Transcript | C40H5.5b.1 (12) | ||||||||
C40H5.5a.1 (12) | |||||||||
Interactor | WBInteraction000003412 | ||||||||
WBInteraction000003413 | |||||||||
WBInteraction000003414 | |||||||||
WBInteraction000003415 | |||||||||
WBInteraction000003416 | |||||||||
WBInteraction000521604 | |||||||||
WBInteraction000569171 | |||||||||
Genetics | Interpolated_map_position | X | 6.70739 | ||||||
Description | Phenotype | WBPhenotype:0001278 | Paper_evidence | WBPaper00004727 | |||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Animals were defective in autoregulation of a ttx-3prom::gfp reporter gene in the AIY interneuron. In Wildtype the expression is strong, in contrast, expression is mostly undetectable in these mutants. | Paper_evidence | WBPaper00004727 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Phenotype_assay | Genotype | ttx-3prom::gfp (mgIs18) | Paper_evidence | WBPaper00004727 | |||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0002513 | Paper_evidence | WBPaper00004727 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Thermotaxis defects mimic those seen upon laser ablation of the AIY interneurons. | Paper_evidence | WBPaper00004727 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Phenotype_not_observed | WBPhenotype:0000424 | Paper_evidence | WBPaper00004906 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutations affecting fate and function of the AIY and AIZ interneurons have no effect on AWA-specific ODR-7 expression | Paper_evidence | WBPaper00004906 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00004906 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | ODR-7 antibody staining | Paper_evidence | WBPaper00004906 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001780 | Paper_evidence | WBPaper00029060 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants show normal butanone enhancement | Paper_evidence | WBPaper00029060 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00029060 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Preexposure to 1:10 dilution of butanone and food. Animals were then subjected to odorant chemotaxis assays and/or selection assays | Paper_evidence | WBPaper00029060 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00029060 | ||||||||
WBPaper00004906 | |||||||||
WBPaper00004727 | |||||||||
Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | ||||||||
[200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | |||||||
Method | Substitution_allele |