WormBase Tree Display for Variation: WBVar00000007
expand all nodes | collapse all nodes | view schema
WBVar00000007 | Evidence | Author_evidence | Curtis L | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ad446 | |||||||
HGVSg | CHROMOSOME_III:g.5612625_5616891delinsAAAAAA | ||||||||
Sequence_details | SMap | S_parent | Sequence | C05D2 | |||||
Flanking_sequences | agactgggcaaaaatctttgacgatctcgaaaatgtggtggtgaa | aaaatacaaaataatgaagtaggcacgtgtatgtaggcag | |||||||
Mapping_target | C05D2 | ||||||||
Type_of_mutation | Insertion | aaaaaa | |||||||
Deletion | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00027310 | ||||||||
WBStrain00027351 | |||||||||
Laboratory | DA | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00015467 | |||||||
WBGene00000239 | |||||||||
Transcript | C05D2.4b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
cDNA_position | 213-? | ||||||||
CDS_position | 198-? | ||||||||
Protein_position | 66-? | ||||||||
Intron_number | 3-8/9 | ||||||||
Exon_number | 3-10/10 | ||||||||
C05D2.3.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
Intron_number | 2-7/9 | ||||||||
Exon_number | 1-7/10 | ||||||||
C05D2.4a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
cDNA_position | 213-? | ||||||||
CDS_position | 198-? | ||||||||
Protein_position | 66-? | ||||||||
Intron_number | 3-7/8 | ||||||||
Exon_number | 3-9/9 | ||||||||
Interactor | WBInteraction000500584 | ||||||||
Isolation | Mutagen | EMS | |||||||
Forward_genetics | standard phenotypic screen | ||||||||
Genetics | Interpolated_map_position | III | -1.46914 | ||||||
Mapping_data | In_multi_point | 2312 | |||||||
2693 | |||||||||
Description | Phenotype | WBPhenotype:0000164 | Paper_evidence | WBPaper00043908 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000224 | Person_evidence | WBPerson384 | |||||||
WBPerson261 | |||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | Low levels of serotonin immunoreactivity seen; possibly not genuine serotonin. | Person_evidence | WBPerson384 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
serotonin-deficient (no detectable serotonin immunoreactivity); serotonin immunoreactivity restored by exposure to serotonin, but not to 5-hydroxytryptophan; poor male turning behavior | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Complete | Person_evidence | WBPerson384 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Recessive | Person_evidence | WBPerson384 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Null | Person_evidence | WBPerson384 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000227 | Paper_evidence | WBPaper00001861 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Similar to cat-4 male turning defective, <40% good turns, frequent sloppy or missed turns. No males were perfect e.g. made good turns 100% of the time. | Paper_evidence | WBPaper00001861 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
poor male turning behavior | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001861 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000234 | Person_evidence | WBPerson384 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Penetrance | Complete | Person_evidence | WBPerson384 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Recessive | Person_evidence | WBPerson384 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Null | Person_evidence | WBPerson384 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000424 | Paper_evidence | WBPaper00001861 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No serotonin-IR (immunoreactivity), can be restored by treatment with serotonin, but not its precursor, 5-HTP. | Paper_evidence | WBPaper00001861 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000648 | Paper_evidence | WBPaper00001861 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutant males seem to be unable to "track" the hermaphrodite after contact, lose contact altogether, have difficulty escaping from spontaneous dorsal inward tail coils, and are more likely to ignore contact with a hermaphrodite. | Paper_evidence | WBPaper00001861 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00001861 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001861 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001005 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001444 | Paper_evidence | WBPaper00032335 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited defective gustatory plasticity of NaCl. | Paper_evidence | WBPaper00032335 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00032335 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were tested for response to 25 mM NaCl after various pre-treatments: a 15-min wash in CTX buffer with or without 100 mM NaCl (liquid), or 30 min on a CTX plate with or without 100 mM NaCl, and in the presence or absence of bacteria, 500 mM glycerol, or 3 uL of benzaldehyde. | Paper_evidence | WBPaper00032335 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002284 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002289 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002293 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002295 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002300 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002303 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002309 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002312 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002319 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002322 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002325 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002328 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002337 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002346 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0004023 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00040570 | ||||||
Curator_confirmed | WBPerson8126 | ||||||||
Remark | Fig.1 (lifespan extension upon reserpine treatment, not different from wild type) | Paper_evidence | WBPaper00040570 | ||||||
Curator_confirmed | WBPerson8126 | ||||||||
Affected_by | Molecule | WBMol:00002955 | Paper_evidence | WBPaper00040570 | |||||
Curator_confirmed | WBPerson8126 | ||||||||
WBPhenotype:0001101 | Paper_evidence | WBPaper00038382 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Clozapine-induced increases in egg laying was present. | Paper_evidence | WBPaper00038382 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003634 | Paper_evidence | WBPaper00038382 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants defective in the synthesis and reception of nonessential excitatory neurotransmitters respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Disease_info | Models_disease | DOID:809 | |||||||
DOID:0050742 | |||||||||
Models_disease_in_annotation | WBDOannot00000679 | ||||||||
WBDOannot00000680 | |||||||||
Reference | WBPaper00038382 | ||||||||
WBPaper00040570 | |||||||||
WBPaper00043908 | |||||||||
WBPaper00031936 | |||||||||
WBPaper00032335 | |||||||||
WBPaper00011911 | |||||||||
WBPaper00001861 | |||||||||
WBPaper00014504 | |||||||||
WBPaper00015782 | |||||||||
Method | Deletion_and_insertion_allele |