WormBase Tree Display for Variation: WBVar00142908
expand all nodes | collapse all nodes | view schema
WBVar00142908 | Evidence | Paper_evidence | WBPaper00006395 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name (3) | |||||||||
Sequence_details | SMap | S_parent | Sequence | T21D12 | |||||
Flanking_sequences | aatgtccaactggagctccaggaccaccag | acttccaggtaaatttgaattgcatcagga | |||||||
Mapping_target | T21D12 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00006395 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004077 | ||||||||
WBStrain00026744 | |||||||||
WBStrain00027172 | |||||||||
WBStrain00027245 | |||||||||
WBStrain00027276 | |||||||||
WBStrain00033525 | |||||||||
WBStrain00035533 | |||||||||
WBStrain00036391 | |||||||||
WBStrain00049370 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001071 | |||||||
Transcript | T21D12.2b.1 (12) | ||||||||
T21D12.2a.1 (12) | |||||||||
Interactor | WBInteraction000503698 | ||||||||
WBInteraction000537309 | |||||||||
Genetics | Interpolated_map_position | IV | -26.772 | ||||||
Mapping_data | In_2_point (16) | ||||||||
In_multi_point (25) | |||||||||
In_pos_neg_data | 2140 | ||||||||
3687 | |||||||||
Description | Phenotype | WBPhenotype:0000135 | Paper_evidence | WBPaper00032031 | |||||
WBPaper00045575 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited a high level of pnlp-29::GFP expression under normal culture conditions, unlike wild type worms. | Paper_evidence | WBPaper00032031 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
As measured by quantitative RT-PCR, the expression of all six genes of the nlp-29 locus was increased in a dpy-10-mutant background, to varying degrees. | Paper_evidence | WBPaper00045575 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | Pnlp-29::GFP | Paper_evidence | WBPaper00032031 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000319 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Large dumpy. Easy to score (ES3) in adult, very hard to score (ES1) in larvae. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score (2) | ||||||||
WBPhenotype:0000420 | Paper_evidence | WBPaper00061220 | |||||||
Curator_confirmed | WBPerson3900 | ||||||||
Remark | Enhanced susceptibility to levamisole (Figure 3K) | Paper_evidence | WBPaper00061220 | ||||||
Curator_confirmed | WBPerson3900 | ||||||||
Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00061220 | |||||
Curator_confirmed | WBPerson3900 | ||||||||
WBPhenotype:0000462 | Paper_evidence | WBPaper00061220 | |||||||
Curator_confirmed | WBPerson3900 | ||||||||
Remark | Enhanced susceptibility to paraquat (Figure 3B) | Paper_evidence | WBPaper00061220 | ||||||
Curator_confirmed | WBPerson3900 | ||||||||
Affected_by | Molecule | WBMol:00002747 | Paper_evidence | WBPaper00061220 | |||||
Curator_confirmed | WBPerson3900 | ||||||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00000031 | |||||||
WBPaper00032031 | |||||||||
WBPaper00032090 | |||||||||
WBPaper00005747 | |||||||||
WBPaper00064435 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
WBPerson2987 | |||||||||
WBPerson6532 | |||||||||
Remark | Large dumpy. Easy to score (ES3) in adult, very hard to score (ES1) in larvae. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Authors report "large dpy" (Table 1) | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | Pnlp-29::GFP | Paper_evidence | WBPaper00032031 | |||||
Curator_confirmed | WBPerson712 | ||||||||
kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000876 | Paper_evidence | WBPaper00032031 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals resist osmotic stress. | Paper_evidence | WBPaper00032031 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | Pnlp-29::GFP | Paper_evidence | WBPaper00032031 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000948 | Paper_evidence | WBPaper00061220 | |||||||
WBPaper00064435 | |||||||||
Curator_confirmed | WBPerson3900 | ||||||||
WBPerson6532 | |||||||||
Remark | Irregular indentations in the cuticle (Figure 2) | Paper_evidence | WBPaper00061220 | ||||||
Curator_confirmed | WBPerson3900 | ||||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001014 | Paper_evidence | WBPaper00032031 | |||||||
WBPaper00061220 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson3900 | |||||||||
Remark | Animals had a markedly increased resistance to D. coniospora infection. | Paper_evidence | WBPaper00032031 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Enhanced resistance to Pseudomonas aeruginosa (Figure S4G) | Paper_evidence | WBPaper00061220 | |||||||
Curator_confirmed | WBPerson3900 | ||||||||
Phenotype_assay | Treatment | Infections with a freshly harvested solution of D. coniospora spores were done as described [65]; worms were analyzed after 24 h at 25C. Worms were pricked in the tail region using a microinjection needle under a dissecting microscope and analyzed 6 h later for GFP induction or 2 hours later for qRT-PCR. | Paper_evidence | WBPaper00032031 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | Pnlp-29::GFP | Paper_evidence | WBPaper00032031 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001236 | Paper_evidence | WBPaper00058872 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | loss of dpy-2 or dpy-9 gene function is associated with increased GFP::DBL-1 fluorescence from texIs100 or texIs101 as shown in (A') and (B'), respectively. dpy-2 and dpy-9 mutants also have reduced spp-9p::gfp reporter activity compared to control (C), as shown in (C') and (C''), respectively. | Paper_evidence | WBPaper00058872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Image | WBPicture0000014937 | Paper_evidence | WBPaper00058872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | TLG702 dpy-9(e12); texIs101 | Paper_evidence | WBPaper00058872 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00058872 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Consistent with the increased GFP::DBL-1 fluorescence at L4, we observed significantly decreased fluorescence from the spp-9p::gfp reporter at L4 (Figure 1, Table 1). T | Paper_evidence | WBPaper00058872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Image | WBPicture0000014937 | Paper_evidence | WBPaper00058872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | TLG724 dpy-9(e12); texIs127 | Paper_evidence | WBPaper00058872 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001412 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Authors report "multiple or discontinuous ala" (Table 1) | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001517 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Authors report "missing or amorphous annuli" (Table 1) | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001918 | Paper_evidence | WBPaper00061220 | |||||||
Curator_confirmed | WBPerson3900 | ||||||||
Remark | Enhanced susceptibility to ivermectin (Figure 3L) | Paper_evidence | WBPaper00061220 | ||||||
Curator_confirmed | WBPerson3900 | ||||||||
Affected_by | Molecule | WBMol:00002786 | Paper_evidence | WBPaper00061220 | |||||
Curator_confirmed | WBPerson3900 | ||||||||
WBPhenotype:0002575 | Paper_evidence | WBPaper00064435 | |||||||
Curator_confirmed | WBPerson6532 | ||||||||
WBPhenotype:0002641 | Paper_evidence | WBPaper00061220 | |||||||
Curator_confirmed | WBPerson3900 | ||||||||
Remark | Cuticle permeable to Hoechst 33258 (Figure S1) | Paper_evidence | WBPaper00061220 | ||||||
Curator_confirmed | WBPerson3900 | ||||||||
Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00032031 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Life span of animals were not greater than that of wild type worms in the absence of infection. | Paper_evidence | WBPaper00032031 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | Pnlp-29::GFP | Paper_evidence | WBPaper00032031 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Disease_info | Models_disease | DOID:37 | |||||||
Models_disease_in_annotation | WBDOannot00001177 | ||||||||
Reference (14) | |||||||||
Method | Substitution_allele |