WormBase Tree Display for Variation: WBVar00143343
expand all nodes | collapse all nodes | view schema
WBVar00143343 | Name | Public_name | e620 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name (2) | |||||||||
HGVSg | CHROMOSOME_X:g.3959108C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | C16B8 | |||||
Flanking_sequences | ccattgaaaggaacggtgccagaatctttg | agggtattcatttcgcgaaacatttttcaa | |||||||
Mapping_target | C16B8 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00024383 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004187 | ||||||||
WBStrain00008502 | |||||||||
WBStrain00008506 | |||||||||
WBStrain00026854 | |||||||||
WBStrain00026896 | |||||||||
WBStrain00027230 | |||||||||
WBStrain00030926 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003007 | |||||||
Transcript | C16B8.1.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C16B8.1.1:c.313C>T | ||||||||
HGVSp | CE44782:p.Gln105Ter | ||||||||
cDNA_position | 321 | ||||||||
CDS_position | 313 | ||||||||
Protein_position | 105 | ||||||||
Exon_number | 4/14 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor (43) | |||||||||
Genetics | Interpolated_map_position | X | -8.86883 | ||||||
Mapping_data | In_multi_point (15) | ||||||||
In_pos_neg_data | 5833 | ||||||||
Description | Phenotype | WBPhenotype:0000038 | Paper_evidence | WBPaper00024693 | |||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | Occasional vulval rupture; slight maternal effect; slightly ts. e620/Df stronger phenotype. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Table 4 | Paper_evidence | WBPaper00024693 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 19 | Paper_evidence | WBPaper00024693 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Temperature_sensitive | Heat_sensitive | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Maternal | With_maternal_effect | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000220 | Paper_evidence | WBPaper00024693 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Vulva cell fate specification was abnormal as indicated by the expression patterns of the cdh-3::CFP and ceh-2::YFP transgenes (Figure 5) | Paper_evidence | WBPaper00024693 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004434 | PATO:0000460 | Paper_evidence | WBPaper00024693 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004435 | PATO:0000460 | Paper_evidence | WBPaper00024693 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004432 | PATO:0000460 | Paper_evidence | WBPaper00024693 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004433 | PATO:0000460 | Paper_evidence | WBPaper00024693 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004436 | PATO:0000460 | Paper_evidence | WBPaper00024693 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004447 | PATO:0000460 | Paper_evidence | WBPaper00024693 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004448 | PATO:0000460 | Paper_evidence | WBPaper00024693 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000239 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Polarity of 2ary lineages variably disrupted. Slight maternal effect; slightly ts. e620/Df stronger phenotype. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Maternal | With_maternal_effect | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000520 | Paper_evidence | WBPaper00024383 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 2 | Paper_evidence | WBPaper00024383 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00024383 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000695 | Paper_evidence | WBPaper00024693 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Figure 5 | Paper_evidence | WBPaper00024693 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000697 | Paper_evidence | WBPaper00024693 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "For example, the main vulva protruded in only 10% of lin-17(n671) mutants and 24% of lin-18(e620) mutants (Table 4)." | Paper_evidence | WBPaper00024693 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 24 | Paper_evidence | WBPaper00024693 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00024693 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000700 | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Single protrusion posterior to the vulva | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Range | 30 | 30 | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00000762 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | |||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00044058 | |||||||
WBPaper00024383 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "As previously reported, VNS::SYS-1 asymmetry in P7.p daughter cells is often lost in lin-17(n671) and lin-18(e620) mutants (Fig 4). These mutants display two aberrant patterns of VNS::SYS- 1 localization as well as the wild-type pattern, though less frequently. The two deviant localization patterns include one in which both P7.pa and P7.pp express equal amounts of VNS::SYS- 1, and a reversed VNS::SYS-1 pattern in which P7.pp is enriched with VNS::SYS-1." | Paper_evidence | WBPaper00044058 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Expression of egl-17::GFP in P7.p descendants was perturbed (Table 1) | Paper_evidence | WBPaper00024383 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Expression of cog-1::GFP in P7.p descendants was perturbed (Table 1) | Paper_evidence | WBPaper00024383 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00024383 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0006895 | PATO:0000460 | Paper_evidence | WBPaper00024383 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | VNS::SYS-1 | Paper_evidence | WBPaper00044058 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
egl-17::GFP | Paper_evidence | WBPaper00024383 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
cog-1::GFP | Paper_evidence | WBPaper00024383 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002011 | Paper_evidence | WBPaper00024383 | |||||||
WBPaper00024693 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | Some (<50%) hermaphrodites have single small protrusion posterior to vulva, slight maternal effect; slightly ts. e620/Df stronger phenotype. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Figure 1, Table 1, Table 2 | Paper_evidence | WBPaper00024383 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Figure 5 | Paper_evidence | WBPaper00024693 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 43 | Paper_evidence | WBPaper00024383 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00024383 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0040025 | PATO:0000460 | Paper_evidence | WBPaper00024383 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Temperature_sensitive | Heat_sensitive | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Maternal | With_maternal_effect | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES2_Difficult_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002193 | Paper_evidence | WBPaper00044058 | |||||||
WBPaper00024383 | |||||||||
WBPaper00024693 | |||||||||
WBPaper00057191 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPerson712 | |||||||||
Remark | Figure 5A, Table 1 | Paper_evidence | WBPaper00024383 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Figure 5B, Table 1 | Paper_evidence | WBPaper00024383 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
"In wild type, the sisters generated by the division of P7.p (P7.pa and P7.pp) most often localized POP-1 in a low/high pattern (21 of 25 specimens). However, in lin-17(n671) mutants, these sisters rarely localized POP-1 in this low/high pattern (1 of 26 specimens) and instead most often localized POP-1 in the reversed high/low pattern (16 of 26 specimens). Likewise in lin-18(e620) mutants, these sisters often localized POP-1 in the reversed high/low pattern (9 of 26 specimens). Due to these reversals, the orientation of POP-1 localization in the P7.px sisters in lin-17 and lin-18 mutants often matches that seen in wild-type P5.px sisters. After the second round of cell division, the pattern of POP-1 localization in the P7.p descendants was also disrupted in lin-17 and lin-18 mutants. The distal pair of sisters (P7.ppa and P7.ppp) showed a higher rate of reversals than the proximal pair of sisters (P7.paa and P7.pap) in both lin-17(n671) and lin-18(e620) mutants." | Paper_evidence | WBPaper00024693 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
"In wild type, vulA cells arise from the posterior daughter of P7.p (P7.pp). However, in lin-17(-), lin-18(-), and in double mutants, vulA cells most commonly arose from the anterior daughter of P7.p (P7.pa). This pattern of vulA specification suggests a reversal in the P7.p lineage at the first round of cell division." (Figure 5, Table 3) | Paper_evidence | WBPaper00024693 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
31% n=100 | Paper_evidence | WBPaper00057191 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Image | WBPicture0000014918 | Paper_evidence | WBPaper00057191 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | 31 | Paper_evidence | WBPaper00044058 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term (13) | ||||||||
GO_term | GO:0040025 | PATO:0000460 | Paper_evidence | WBPaper00024383 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | egl-17::GFP | Paper_evidence | WBPaper00024383 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
cog-1::GFP | Paper_evidence | WBPaper00024383 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002216 | Paper_evidence | WBPaper00024693 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "In wild type, the sisters generated by the division of P7.p (P7.pa and P7.pp) most often localized POP-1 in a low/high pattern (21 of 25 specimens). However, in lin-17(n671) mutants, these sisters rarely localized POP-1 in this low/high pattern (1 of 26 specimens) and instead most often localized POP-1 in the reversed high/low pattern (16 of 26 specimens). Likewise in lin-18(e620) mutants, these sisters often localized POP-1 in the reversed high/low pattern (9 of 26 specimens). Due to these reversals, the orientation of POP-1 localization in the P7.px sisters in lin-17 and lin-18 mutants often matches that seen in wild-type P5.px sisters. After the second round of cell division, the pattern of POP-1 localization in the P7.p descendants was also disrupted in lin-17 and lin-18 mutants. The distal pair of sisters (P7.ppa and P7.ppp) showed a higher rate of reversals than the proximal pair of sisters (P7.paa and P7.pap) in both lin-17(n671) and lin-18(e620) mutants." | Paper_evidence | WBPaper00024693 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006983 | PATO:0000460 | Paper_evidence | WBPaper00024693 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0006984 | PATO:0000460 | Paper_evidence | WBPaper00024693 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0007265 | PATO:0000460 | Paper_evidence | WBPaper00024693 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0007266 | PATO:0000460 | Paper_evidence | WBPaper00024693 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000104 | Paper_evidence | WBPaper00044679 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | The lin-18(e620) mutation does not affect anteroposterior polarity in the AVG interneuron | Paper_evidence | WBPaper00044679 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003850 | PATO:0000460 | Paper_evidence | WBPaper00044679 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000218 | Paper_evidence | WBPaper00031110 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No significant number of overinduced animals (worms with greater than three VPCs induced) were detected. | Paper_evidence | WBPaper00031110 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031110 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000219 | Paper_evidence | WBPaper00031110 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No underinduced animals (worms with fewer than 22 vulval cells or fewer than three VPCs induced) were detected. | Paper_evidence | WBPaper00031110 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031110 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000648 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000883 | Paper_evidence | WBPaper00035405 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Nerve ring development is normal | Paper_evidence | WBPaper00035405 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001024 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males phenotypically wildtype. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001224 | Paper_evidence | WBPaper00060654 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | There are six Wnt receptors encoded in the C. elegans genome: four Frizzled receptors (LIN-17, CFZ-2, MIG-1 and MOM-5,), one Ror receptor (CAM-1) and one Ryk receptor (LIN-18) (Sawa and Korswagen, 2013). We analyzed the effect of loss-of-function mutations for each receptor and found that loss of cam-1, but not the other receptors, caused defective SMDD axonal development (Figure 1D). | Paper_evidence | WBPaper00060654 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004972 | PATO:0000460 | Paper_evidence | WBPaper00060654 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0004971 | PATO:0000460 | Paper_evidence | WBPaper00060654 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001235 | Paper_evidence | WBPaper00004436 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Animals exhibited wild type V5 cell division polarity (Table 2) | Paper_evidence | WBPaper00004436 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004890 | PATO:0000460 | Paper_evidence | WBPaper00004436 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004876 | PATO:0000460 | Paper_evidence | WBPaper00004436 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004250 | PATO:0000460 | Paper_evidence | WBPaper00004436 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0007446 | PATO:0000460 | Paper_evidence | WBPaper00004436 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004246 | PATO:0000460 | Paper_evidence | WBPaper00004436 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0007463 | PATO:0000460 | Paper_evidence | WBPaper00004436 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00004436 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00004436 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference (15) | |||||||||
Method | Substitution_allele |