WormBase Tree Display for Variation: WBVar00143753
expand all nodes | collapse all nodes | view schema
WBVar00143753 | Evidence | Paper_evidence | WBPaper00003844 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e1112 | ||||||
Other_name | B0432.5b.1:c.631C>T | |||||||
CE37742:p.Gln211Ter | ||||||||
B0432.5c.1:c.826C>T | ||||||||
B0432.5a.1:c.841C>T | ||||||||
Y43H11AL.3a.2:c.-13+3945G>A | ||||||||
CE45548:p.Gln276Ter | ||||||||
CE29946:p.Gln281Ter | ||||||||
HGVSg | CHROMOSOME_II:g.259619C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | B0432 | ||||
Flanking_sequences | gcggtatatcggcaaaatttgaaaattctc | aagaggagaaggttttgacagcggatagga | ||||||
Mapping_target | B0432 | |||||||
Type_of_mutation | Substitution | c | t | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004246 | |||||||
WBStrain00034688 | ||||||||
WBStrain00055863 | ||||||||
WBStrain00055864 | ||||||||
WBStrain00055865 | ||||||||
Laboratory | CB | |||||||
IV | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00004166 | ||||||
WBGene00000296 | ||||||||
Transcript | Y43H11AL.3a.2 | VEP_consequence | intron_variant | |||||
VEP_impact | MODIFIER | |||||||
HGVSc | Y43H11AL.3a.2:c.-13+3945G>A | |||||||
Intron_number | 1/28 | |||||||
B0432.5c.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | B0432.5c.1:c.826C>T | |||||||
HGVSp | CE45548:p.Gln276Ter | |||||||
cDNA_position | 910 | |||||||
CDS_position | 826 | |||||||
Protein_position | 276 | |||||||
Exon_number | 5/9 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
B0432.5a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | B0432.5a.1:c.841C>T | |||||||
HGVSp | CE29946:p.Gln281Ter | |||||||
cDNA_position | 841 | |||||||
CDS_position | 841 | |||||||
Protein_position | 281 | |||||||
Exon_number | 4/9 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
B0432.5b.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | B0432.5b.1:c.631C>T | |||||||
HGVSp | CE37742:p.Gln211Ter | |||||||
cDNA_position | 1547 | |||||||
CDS_position | 631 | |||||||
Protein_position | 211 | |||||||
Exon_number | 4/9 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
Genetics | Interpolated_map_position | II | -15.661 | |||||
Mapping_data | In_2_point | 34 | ||||||
797 | ||||||||
In_multi_point | 45 | |||||||
273 | ||||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00049285 | ||||
WBPaper00059778 | ||||||||
Curator_confirmed | WBPerson33374 | |||||||
WBPerson23309 | ||||||||
Remark | selectively during roaming state | Paper_evidence | WBPaper00059778 | |||||
Curator_confirmed | WBPerson23309 | |||||||
WBPhenotype:0000164 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000227 | Paper_evidence | WBPaper00001861 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Mutants were close to WT in turning ability | Paper_evidence | WBPaper00001861 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000233 | Paper_evidence | WBPaper00000365 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Dopamine levels are depleted. | Paper_evidence | WBPaper00000365 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000234 | Paper_evidence | WBPaper00036154 | ||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibited ~75% reduction of dopamine levels as compared to N2. | Paper_evidence | WBPaper00036154 | |||||
Curator_confirmed | WBPerson712 | |||||||
Dopamine reduced > 95%. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Ease_of_scoring | ES1_Very_hard_to_score | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000284 | Paper_evidence | WBPaper00045365 | ||||||
Curator_confirmed | WBPerson3609 | |||||||
WBPhenotype:0000319 | Paper_evidence | WBPaper00049285 | ||||||
Curator_confirmed | WBPerson33374 | |||||||
WBPhenotype:0000324 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000412 | Paper_evidence | WBPaper00045567 | ||||||
Curator_confirmed | WBPerson2162 | |||||||
WBPhenotype:0000641 | Paper_evidence | WBPaper00041213 | ||||||
Curator_confirmed | WBPerson461 | |||||||
Remark | The locomotion rates of cat-2 mutants were more variable than those of wild-type animals; cat-2 mutants achieve greater peak acceleration, resulting in large fluctuations in the speed within tracks. | Paper_evidence | WBPaper00041213 | |||||
Curator_confirmed | WBPerson461 | |||||||
WBPhenotype:0000642 | Paper_evidence | WBPaper00036154 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals are hyperactive throughout adulthood starting on adult day 0. Treatment with exogenous dopamine rescued the locomotor dysfunction. | Paper_evidence | WBPaper00036154 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000648 | Paper_evidence | WBPaper00001861 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Mutants exhibit a relative lack of interest in the hermaphrodite. | Paper_evidence | WBPaper00001861 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000662 | Paper_evidence | WBPaper00006375 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | ARS defective. Animals do not exhibit a higher frequency of high-angled turns during the first 5 minutes observation period. | Paper_evidence | WBPaper00006375 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001005 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001265 | Paper_evidence | WBPaper00042154 | ||||||
Curator_confirmed | WBPerson1455 | |||||||
Remark | In free locomotion, small movement of the head end is slower than the wild type (Fig. 6 and Table 3). | Paper_evidence | WBPaper00042154 | |||||
Curator_confirmed | WBPerson1455 | |||||||
WBPhenotype:0001437 | Paper_evidence | WBPaper00028963 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Hypersensitive to dilute concentrations of octanol, based on a comparison with wild type of time it takes to respond. | Paper_evidence | WBPaper00028963 | |||||
Curator_confirmed | WBPerson48 | |||||||
Phenotype_assay | Treatment | 5% octanol, on food | Paper_evidence | WBPaper00028963 | ||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0001444 | Paper_evidence | WBPaper00032335 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals were strongly defective in gustatory plasticity. | Paper_evidence | WBPaper00032335 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Animals were tested for response to 25 mM NaCl after various pre-treatments: a 15-min wash in CTX buffer with or without 100 mM NaCl (liquid), or 30 min on a CTX plate with or without 100 mM NaCl, and in the presence or absence of bacteria, 500 mM glycerol, or 3 uL of benzaldehyde. | Paper_evidence | WBPaper00032335 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001518 | Paper_evidence | WBPaper00000365 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Formaldehyde induced fluorescence is (FIF) absent. | Paper_evidence | WBPaper00000365 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001716 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001817 | Paper_evidence | WBPaper00032335 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibited weak, but significant, reduced starvation-enhanced gustatory plasticity compared to wild type. | Paper_evidence | WBPaper00032335 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002284 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002288 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002293 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002295 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002298 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002301 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002308 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002312 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002319 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002323 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002335 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002345 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0004022 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0004023 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0004028 | Paper_evidence | WBPaper00036154 | ||||||
WBPaper00038270 | ||||||||
WBPaper00041132 | ||||||||
Curator_confirmed | WBPerson712 | |||||||
WBPerson557 | ||||||||
Remark | Animals do not exhibit a basal slowing response in response to food, unlike control animals. Animals failed to slow their body bending rate. | Paper_evidence | WBPaper00036154 | |||||
Curator_confirmed | WBPerson712 | |||||||
mutants fail to slow in response to food | Paper_evidence | WBPaper00038270 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Complete | Paper_evidence | WBPaper00038270 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed (17) | ||||||||
Disease_info | Models_disease | DOID:670 | ||||||
DOID:809 | ||||||||
DOID:14330 | ||||||||
DOID:0050742 | ||||||||
Models_disease_in_annotation (4) | ||||||||
Reference (35) | ||||||||
Method | Substitution_allele |