WormBase Tree Display for Variation: WBVar00241110
expand all nodes | collapse all nodes | view schema
WBVar00241110 | Evidence | Paper_evidence | WBPaper00002046 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | q420 | |||||||
Other_name | Y73C8B.4.1:c.725-1G>A | ||||||||
HGVSg | CHROMOSOME_V:g.3189356G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y73C8B | |||||
Flanking_sequences | agagtctagacatgagaatttgttttttca | gcgccaaatgcttcccaaacggtccgaaag | |||||||
Mapping_target | Y73C8B | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002046 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00022546 | ||||||||
Laboratory | JK | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00002246 | |||||||
Transcript | Y73C8B.4.1 | VEP_consequence | splice_acceptor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y73C8B.4.1:c.725-1G>A | ||||||||
Intron_number | 3/4 | ||||||||
Interactor | WBInteraction000521259 | ||||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00002046 | |||||
Genetics | Interpolated_map_position | V | -12.7104 | ||||||
Description | Phenotype | WBPhenotype:0000081 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Larval arrest at L1. Weaker allele than q387. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000024 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000094 | Paper_evidence | WBPaper00001423 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Anus is absent. A protrusion is present at the normal location of the anal opening | Paper_evidence | WBPaper00001423 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Incomplete | 88 percent of L1 lethals lack both the excretory cell and rectum/anus. 12 percent of L1 lethals lack either the excretory cell and rectum/anus | Paper_evidence | WBPaper00001423 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001423 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001423 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations (2) | |||||||||
WBPhenotype:0000117 | Paper_evidence | WBPaper00001423 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001423 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001423 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00001423 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000315 | Paper_evidence | WBPaper00038400 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals had a lower arousal threshold to mechanosensory stimuli than control animals; animals responded more frequently to stimuli than control quiescent animals. | Paper_evidence | WBPaper00038400 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00038400 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00038400 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000412 | Paper_evidence | WBPaper00038400 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals were defective in their response to octanol at the restrictive temperature but responded normally when reared at the permissive temperature. | Paper_evidence | WBPaper00038400 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00038400 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00001966 | Paper_evidence | WBPaper00038400 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00038400 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000621 | Paper_evidence | WBPaper00001423 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | There is no detectable excretory cell or excretory duct and a small protrusion is present at the normal location of the excretory pore. In some mutants, a duplicated structure near the excretory pore was observed using an antibody that recognizes epithelial belt desmosomes | Paper_evidence | WBPaper00001423 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Incomplete | 88 percent of L1 lethals lack both the excretory cell and rectum/anus. 12 percent of L1 lethals lack either the excretory cell and rectum/anus | Paper_evidence | WBPaper00001423 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001423 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001423 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations (2) | |||||||||
Phenotype_assay | Treatment | MH27 antibody staining | Paper_evidence | WBPaper00001423 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000622 | Paper_evidence | WBPaper00001423 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | In the case of lag-2(q420), occasional animals were found in which there appeared to be an ectopic anal depressor muscle. | Paper_evidence | WBPaper00001423 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001423 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001423 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00001423 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Antibody staining to myosin heavy chain A | Paper_evidence | WBPaper00001423 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000641 | Paper_evidence | WBPaper00038400 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited increased basal locomotion activity, twice the number of body bends per minute than observed for control animals. | Paper_evidence | WBPaper00038400 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00038400 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00038400 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000857 | Paper_evidence | WBPaper00039902 | |||||||
Curator_confirmed | WBPerson43879 | ||||||||
Remark | Figure 5. Duct and G1 pore fail to stack, variable absence of canal cell | Paper_evidence | WBPaper00039902 | ||||||
Curator_confirmed | WBPerson43879 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00039902 | ||||||
Curator_confirmed | WBPerson43879 | ||||||||
WBPhenotype:0001098 | Paper_evidence | WBPaper00001423 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The rectum is undetectable | Paper_evidence | WBPaper00001423 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Incomplete | 88 percent of L1 lethals lack both the excretory cell and rectum/anus. 12 percent of L1 lethals lack either the excretory cell and rectum/anus | Paper_evidence | WBPaper00001423 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001423 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001423 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations (2) | |||||||||
WBPhenotype:0001099 | Paper_evidence | WBPaper00001423 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Incomplete | 2 percent of L1 lethals have a twisted nose | Paper_evidence | WBPaper00001423 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001423 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001423 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00001423 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001183 | Paper_evidence | WBPaper00032310 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | lag-2(q420ts) mutants showed a 50% decrease in fat storage (Figure 2G) | Paper_evidence | WBPaper00032310 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001524 | Paper_evidence | WBPaper00038400 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited increased L4/A quiescence compared to control animals. | Paper_evidence | WBPaper00038400 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00038400 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00038400 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001586 | Paper_evidence | WBPaper00001423 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Adults often possess a protruding vulva, which is associated with the production of two anchor cells | Paper_evidence | WBPaper00001423 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001423 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001423 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000035 | PATO:0000460 | Paper_evidence | WBPaper00001423 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00001423 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001597 | Paper_evidence | WBPaper00001423 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The anal depressor muscle and at least one intestinal muscle were absent. | Paper_evidence | WBPaper00001423 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001423 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001423 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations (2) | |||||||||
Phenotype_assay | Treatment | Antibody staining to myosin heavy chain A | Paper_evidence | WBPaper00001423 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000594 | Paper_evidence | WBPaper00004662 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We also observed the migration of P11/12 in a lag-2 mutant. LAG-2 is one of the four C_elegans homologs of the Delta protein, which is the ligand of Notch in Drosophila (Henderson et_al, 1994; Tax et_al, 1994). P11/12 migration is not clearly affected in this temperature-sensitive hypomorphic allele, although the bias in orientation may be reduced (Table 1C)." | Paper_evidence | WBPaper00004662 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004409 | PATO:0000460 | Paper_evidence | WBPaper00004662 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00038400 | ||||||||
WBPaper00006052 | |||||||||
WBPaper00004883 | |||||||||
WBPaper00032310 | |||||||||
WBPaper00001423 | |||||||||
WBPaper00004662 | |||||||||
WBPaper00039902 | |||||||||
Method | Substitution_allele |