WormBase Tree Display for Variation: WBVar00241264
expand all nodes | collapse all nodes | view schema
WBVar00241264 | Evidence | Paper_evidence | WBPaper00005204 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | qm150 | |||||||
Other_name (2) | |||||||||
HGVSg | CHROMOSOME_IV:g.8134970G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F42G8 | |||||
Flanking_sequences | attggagtgtgcacccatcttggatgtgtc | caattggtatgcagtcttttttctcctgaa | |||||||
Mapping_target | F42G8 | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00026669 | ||||||||
WBStrain00026670 | |||||||||
WBStrain00026672 | |||||||||
WBStrain00026674 | |||||||||
WBStrain00052465 | |||||||||
Laboratory | MQ | ||||||||
Status | Live | ||||||||
Linked_to | WBVar02146353 | ||||||||
WBVar02146354 | |||||||||
WBVar02146355 | |||||||||
WBVar02146356 | |||||||||
WBVar02146357 | |||||||||
WBVar02146358 | |||||||||
WBVar02146359 | |||||||||
WBVar02146360 | |||||||||
Affects | Gene | WBGene00002162 | |||||||
Transcript | F42G8.12.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | ||||||||
HGVSc | F42G8.12.1:c.673C>T | ||||||||
HGVSp | CE17071:p.Pro225Ser | ||||||||
cDNA_position | 688 | ||||||||
CDS_position | 673 | ||||||||
Protein_position | 225 | ||||||||
Exon_number | 7/10 | ||||||||
Codon_change | Cca/Tca | ||||||||
Amino_acid_change | P/S | ||||||||
Interactor (45) | |||||||||
Genetics | Interpolated_map_position | IV | 3.6222 | ||||||
Mapping_data | In_multi_point | 4448 | |||||||
Description | Phenotype | WBPhenotype:0000031 | Paper_evidence | WBPaper00035965 | |||||
WBPaper00041212 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson2987 | |||||||||
Remark | isp-1 mutants are slow growing than wild-type animals | Paper_evidence | WBPaper00035965 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
"As previously demonstrated, both clk-1(qm30) and isp-1(qm150) worms developed considerably slower than wild-type animals [22,28]." | Paper_evidence | WBPaper00041212 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000042 | Paper_evidence | WBPaper00046760 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Figure 3e | Paper_evidence | WBPaper00046760 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000061 | Paper_evidence | WBPaper00035965 | |||||||
WBPaper00027157 | |||||||||
WBPaper00039835 | |||||||||
WBPaper00040961 | |||||||||
WBPaper00045028 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
WBPerson557 | |||||||||
WBPerson2987 | |||||||||
Remark | isp-1 mutants live longer than wild-type animals | Paper_evidence | WBPaper00035965 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Mutants are long-lived. | Paper_evidence | WBPaper00027157 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
"Even when this delay is taken into account, mutation of isp-1 significantly increased the lifespan of animals treated with atfs-1(RNAi) comparably to animals treated with empty vector RNAi (Fig. 6a), despite the fact that atfs-1(RNAi) completely prevented induction of GFP in isp-1(qm150) animals expressing the hsp-6p::gfp reporter (Fig. 6b)." | Paper_evidence | WBPaper00045028 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | atfs-1(RNAi) | Paper_evidence | WBPaper00045028 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000463 | Paper_evidence | WBPaper00041750 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | isp-1(qm150) mutants were found to produce several metabolite compounds in significantly altered amounts relative to wild-type worms. Long-lived isp-1(qm150) mutants markedly, and significantly, overproduce a variety of alpha-ketoacids and alpha-hydroxyacids relative to wild-type N2 worms (Figure 1, S1). | Paper_evidence | WBPaper00041750 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000523 | Paper_evidence | WBPaper00058699 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | We found that isp-1 and atp-2 strains had decreased worm length when exposed to low concentrations of sodium arsenite. The isp-1 strain has decreased growth when exposed to low concentrations of sodium arsenite but does not appear to have differences in ATP content or lethality compared to N2 controls. | Paper_evidence | WBPaper00058699 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Image | WBPicture0000014932 | Paper_evidence | WBPaper00058699 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00001860 | Paper_evidence | WBPaper00058699 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001236 | Paper_evidence | WBPaper00041212 | |||||||
WBPaper00043917 | |||||||||
WBPaper00045028 | |||||||||
WBPaper00046760 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We next investigated ATFS-1-dependent hsp-60pr::gfp activation in strains harboring the well-characterized clk-1(qm30) or isp- 1(qm150) mutations [26,27]... As both mutations affect respiration and display impaired development [22,23], we hypothesized that they would cause activation of the UPRmt. Indeed, hsp-60pr::gfp expression was consistently elevated in both strains consistent with the presence of mitochondrial stress. The isp-1(qm150) mutation caused considerably stronger hsp-60pr::gfp induction suggestive of a larger impact on mitochondrial function [29] (Figure 1B)." | Paper_evidence | WBPaper00041212 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
"Genetic interference with the ETC by the introduction of a missense mutation in the isp-1 allele qm150 increases mitochondrial superoxide [34]. Supporting our previous findings, hsp-6::gfp was induced as well. GFP was constitutively expressed in the isp-1(qm150) mutant through all developmental stages and adulthood (Figure 3A)." | Paper_evidence | WBPaper00043917 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
isp-1(qm150) causes induction of expression of GFP from the hsp-6 promoter (Figure 6b) | Paper_evidence | WBPaper00045028 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
"The resulting isp-1(qm150);hsp-6::gfp strain showed a constitutive activation of hsp-6::gfp in larvae and adult worms, revealing a strong and continuous mitochondrial stress (Supplementary Note 7)." | Paper_evidence | WBPaper00046760 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | GO_term | GO:0034514 | PATO:0000460 | Paper_evidence | WBPaper00043917 | ||||
WBPaper00046760 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | hsp-60pr::gfp | Paper_evidence | WBPaper00041212 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
zcIs13 [Phsp-6::GFP] | Paper_evidence | WBPaper00043917 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
zcIs13 [hsp-6p::gfp] | Paper_evidence | WBPaper00045028 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
zcIs13[hsp-6::GFP] | Paper_evidence | WBPaper00046760 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001273 | Paper_evidence | WBPaper00045263 | |||||||
Curator_confirmed | WBPerson11905 | ||||||||
Remark | Extremely low survival rate after treatment at 37C for 4 hours. | Paper_evidence | WBPaper00045263 | ||||||
Curator_confirmed | WBPerson11905 | ||||||||
WBPhenotype:0001282 | Paper_evidence | WBPaper00047030 | |||||||
Curator_confirmed | WBPerson25433 | ||||||||
Remark | Reduced maximal respiratory capacity, and increased proton leak measured in L4 stage nematodes | Paper_evidence | WBPaper00047030 | ||||||
Curator_confirmed | WBPerson25433 | ||||||||
EQ_annotations | Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00047030 | ||||
Curator_confirmed | WBPerson25433 | ||||||||
GO_term | GO:0009060 | PATO:0000460 | Paper_evidence | WBPaper00047030 | |||||
Curator_confirmed | WBPerson25433 | ||||||||
GO:0005739 | PATO:0000460 | Paper_evidence | WBPaper00047030 | ||||||
Curator_confirmed | WBPerson25433 | ||||||||
WBPhenotype:0001350 | Paper_evidence | WBPaper00041212 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "... phospho-eIF2a levels were increased relative to total eIF2a protein levels in the clk-1(qm30) mutant... (Figure 4A)... A similar result was observed in the isp-1(qm150) mutant... (Figure 4B)." | Paper_evidence | WBPaper00041212 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001575 | Paper_evidence | WBPaper00045263 | |||||||
Curator_confirmed | WBPerson11905 | ||||||||
WBPhenotype:0002218 | Paper_evidence | WBPaper00049659 | |||||||
Curator_confirmed | WBPerson3701 | ||||||||
Affected_by | Molecule | WBMol:00004596 | Paper_evidence | WBPaper00049659 | |||||
Curator_confirmed | WBPerson3701 | ||||||||
Phenotype_not_observed | WBPhenotype:0000727 | Paper_evidence | WBPaper00041750 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Dihydrolipoamide dehydrogenase (DLD) enzyme activity was unaffected by the isp-1(qm150) mutation (Figure 2G) | Paper_evidence | WBPaper00041750 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | DLD activity in whole-worm extracts was determined spectrophotometrically, exactly as previously described (Bhaskaran et al., 2011). | Paper_evidence | WBPaper00041750 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference (24) | |||||||||
Method | Substitution_allele |