WormBase Tree Display for Variation: WBVar00275093
expand all nodes | collapse all nodes | view schema
WBVar00275093 | Name | Public_name | vs105 | |||||
---|---|---|---|---|---|---|---|---|
Other_name (12) | ||||||||
HGVSg | CHROMOSOME_V:g.9609233_9609313del | |||||||
Sequence_details | SMap | S_parent | Sequence | K09G1 | ||||
Flanking_sequences | taataaaaaagtatattttcttttcaggta | gtggccatcatagttatgccatacgcggtt | ||||||
Mapping_target | K09G1 | |||||||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (12) | ||||||||
Laboratory | LX | |||||||
CF | ||||||||
IV | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00001053 | ||||||
Transcript | K09G1.4e.1 | VEP_consequence | inframe_deletion | |||||
VEP_impact | MODERATE | |||||||
HGVSc | K09G1.4e.1:c.175_255del | |||||||
HGVSp | CE53007:p.Ile59_Leu85del | |||||||
cDNA_position | 175-255 | |||||||
CDS_position | 175-255 | |||||||
Protein_position | 59-85 | |||||||
Exon_number | 2/16 | |||||||
Codon_change | ATAATATCAGTACTCCGGTACCGAGCACTGCAATCAGCCATCAATTTCCTTATCCTAGGCCTGGCTGTGGCGGATCTTTTG/- | |||||||
Amino_acid_change | IISVLRYRALQSAINFLILGLAVADLL/- | |||||||
K09G1.4f.1 | VEP_consequence | inframe_deletion | ||||||
VEP_impact | MODERATE | |||||||
HGVSc | K09G1.4f.1:c.175_255del | |||||||
HGVSp | CE53034:p.Ile59_Leu85del | |||||||
cDNA_position | 175-255 | |||||||
CDS_position | 175-255 | |||||||
Protein_position | 59-85 | |||||||
Exon_number | 2/15 | |||||||
Codon_change | ATAATATCAGTACTCCGGTACCGAGCACTGCAATCAGCCATCAATTTCCTTATCCTAGGCCTGGCTGTGGCGGATCTTTTG/- | |||||||
Amino_acid_change | IISVLRYRALQSAINFLILGLAVADLL/- | |||||||
K09G1.4a.1 | VEP_consequence | inframe_deletion | ||||||
VEP_impact | MODERATE | |||||||
HGVSc | K09G1.4a.1:c.175_255del | |||||||
HGVSp | CE35993:p.Ile59_Leu85del | |||||||
cDNA_position | 193-273 | |||||||
CDS_position | 175-255 | |||||||
Protein_position | 59-85 | |||||||
Exon_number | 3/16 | |||||||
Codon_change | ATAATATCAGTACTCCGGTACCGAGCACTGCAATCAGCCATCAATTTCCTTATCCTAGGCCTGGCTGTGGCGGATCTTTTG/- | |||||||
Amino_acid_change | IISVLRYRALQSAINFLILGLAVADLL/- | |||||||
K09G1.4g.1 | VEP_consequence | inframe_deletion | ||||||
VEP_impact | MODERATE | |||||||
HGVSc | K09G1.4g.1:c.175_255del | |||||||
HGVSp | CE52992:p.Ile59_Leu85del | |||||||
cDNA_position | 191-271 | |||||||
CDS_position | 175-255 | |||||||
Protein_position | 59-85 | |||||||
Exon_number | 3/16 | |||||||
Codon_change | ATAATATCAGTACTCCGGTACCGAGCACTGCAATCAGCCATCAATTTCCTTATCCTAGGCCTGGCTGTGGCGGATCTTTTG/- | |||||||
Amino_acid_change | IISVLRYRALQSAINFLILGLAVADLL/- | |||||||
K09G1.4d.1 | VEP_consequence | inframe_deletion | ||||||
VEP_impact | MODERATE | |||||||
HGVSc | K09G1.4d.1:c.175_255del | |||||||
HGVSp | CE46806:p.Ile59_Leu85del | |||||||
cDNA_position | 194-274 | |||||||
CDS_position | 175-255 | |||||||
Protein_position | 59-85 | |||||||
Exon_number | 3/17 | |||||||
Codon_change | ATAATATCAGTACTCCGGTACCGAGCACTGCAATCAGCCATCAATTTCCTTATCCTAGGCCTGGCTGTGGCGGATCTTTTG/- | |||||||
Amino_acid_change | IISVLRYRALQSAINFLILGLAVADLL/- | |||||||
K09G1.4c.1 | VEP_consequence | inframe_deletion | ||||||
VEP_impact | MODERATE | |||||||
HGVSc | K09G1.4c.1:c.175_255del | |||||||
HGVSp | CE45633:p.Ile59_Leu85del | |||||||
cDNA_position | 199-279 | |||||||
CDS_position | 175-255 | |||||||
Protein_position | 59-85 | |||||||
Exon_number | 3/17 | |||||||
Codon_change | ATAATATCAGTACTCCGGTACCGAGCACTGCAATCAGCCATCAATTTCCTTATCCTAGGCCTGGCTGTGGCGGATCTTTTG/- | |||||||
Amino_acid_change | IISVLRYRALQSAINFLILGLAVADLL/- | |||||||
Interactor | WBInteraction000518035 | |||||||
Genetics | Interpolated_map_position | V | 2.05496 | |||||
Description | Phenotype | WBPhenotype:0000525 | Paper_evidence | WBPaper00041959 | ||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Wild-type worms climb the nicotine gradient, that is worms approach the nicotine spot in a time- and concentration dependent manner. These mutants have reduced nicotine approach behavior. | Paper_evidence | WBPaper00041959 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Treatment | Worms placed on a nicotine gradient. The nicotine gradient was formed by adding 10 uL of 50 mm nicotine tartrate salt solution in water and allowed 90 minutes to diffuse. | Paper_evidence | WBPaper00041959 | ||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0000542 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001444 | Paper_evidence | WBPaper00032335 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals showed defects in gustatory plasticity. | Paper_evidence | WBPaper00032335 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Animals were tested for response to 25 mM NaCl after various pre-treatments: a 15-min wash in CTX buffer with or without 100 mM NaCl (liquid), or 30 min on a CTX plate with or without 100 mM NaCl, and in the presence or absence of bacteria, 500 mM glycerol, or 3 uL of benzaldehyde. | Paper_evidence | WBPaper00032335 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001573 | Paper_evidence | WBPaper00041959 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Wild-type worms climb the nicotine gradient, that is worms approach the nicotine spot in a time- and concentration dependent manner. These mutants have reduced nicotine approach behavior. | Paper_evidence | WBPaper00041959 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Treatment | Worms placed on a nicotine gradient. The nicotine gradient was formed by adding 10 uL of 50 mm nicotine tartrate salt solution in water and allowed 90 minutes to diffuse. | Paper_evidence | WBPaper00041959 | ||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0001639 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002286 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002289 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002293 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002300 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002302 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002310 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002312 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002325 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002344 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002347 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0004022 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_not_observed | WBPhenotype:0001006 | Paper_evidence | WBPaper00044757 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Figure S2C | Paper_evidence | WBPaper00044757 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001012 | Paper_evidence | WBPaper00032196 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals were as susceptible to infection by P. aeruginosa as N2 animals. | Paper_evidence | WBPaper00032196 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Strain | WBStrain00026373 | Paper_evidence | WBPaper00032196 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001101 | Paper_evidence | WBPaper00038382 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | No effects on clozapine-induced egg laying were observed. | Paper_evidence | WBPaper00038382 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00003634 | Paper_evidence | WBPaper00038382 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001182 | Paper_evidence | WBPaper00044757 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Figure 2A | Paper_evidence | WBPaper00044757 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001817 | Paper_evidence | WBPaper00032335 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibited enhanced-gustatory plasticity, i.e. strong avoidance to NaCl after starvation, similar to that observed for wild type. | Paper_evidence | WBPaper00032335 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00032335 | ||||
Curator_confirmed | WBPerson712 | |||||||
Disease_info | Models_disease | DOID:0050742 | ||||||
Modifies_disease | DOID:680 | |||||||
Models_disease_in_annotation | WBDOannot00000688 | |||||||
Modifies_disease_in_annotation | WBDOannot00000764 | |||||||
WBDOannot00000766 | ||||||||
WBDOannot00000767 | ||||||||
Reference | WBPaper00038382 | |||||||
WBPaper00041959 | ||||||||
WBPaper00043908 | ||||||||
WBPaper00032196 | ||||||||
WBPaper00032335 | ||||||||
WBPaper00044757 | ||||||||
WBPaper00065340 | ||||||||
WBPaper00065715 | ||||||||
Remark | This deletion removes most of the first and second transmembrane domain and the splice acceptor for exon 2. | Paper_evidence | WBPaper00024390 | |||||
Method | Deletion_allele |