WormBase Tree Display for Variation: WBVar00090676
expand all nodes | collapse all nodes | view schema
| WBVar00090676 | Evidence | Paper_evidence | WBPaper00005190 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | n3264 | |||||
| Other_name (11) | |||||||
| HGVSg | CHROMOSOME_III:g.7589505G>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | R13A5 | |||
| Flanking_sequences | tcatgacgtgtgccattgtactttacgctg | tttcttgattgccggatgggttattattgg | |||||
| Mapping_target | R13A5 | ||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00005190 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | MT | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00000846 | |||||
| Transcript | R13A5.1d.1 (12) | ||||||
| R13A5.1c.1 (12) | |||||||
| R13A5.1b.1 (12) | |||||||
| R13A5.1a.1 (12) | |||||||
| R13A5.1a.2 | VEP_consequence | missense_variant | |||||
| VEP_impact | MODERATE | ||||||
| SIFT | 0 | deleterious | |||||
| PolyPhen | 1 | probably_damaging | |||||
| HGVSc | R13A5.1a.2:c.1406G>A | ||||||
| HGVSp | CE45023:p.Gly469Asp | ||||||
| cDNA_position | 1429 | ||||||
| CDS_position | 1406 | ||||||
| Protein_position | 469 | ||||||
| Exon_number | 7/12 | ||||||
| Codon_change | gGt/gAt | ||||||
| Amino_acid_change | G/D | ||||||
| R13A5.1e.1 (12) | |||||||
| Genetics | Interpolated_map_position | III | -0.663209 | ||||
| Description | Phenotype (5) | ||||||
| Phenotype_not_observed | WBPhenotype:0000052 | Paper_evidence | WBPaper00005190 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | This mutant failed to complement n3194 for maternal-effect lethality; however, it does not confer a maternal-effect lethal phenotype on its own; n3264 seems to be a partial loss-of-function allele. | Paper_evidence | WBPaper00005190 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00005190 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00005190 | ||||||
| Method | Substitution_allele |
