WormBase Tree Display for Variation: WBVar00250815
expand all nodes | collapse all nodes | view schema
WBVar00250815 | Name | Public_name | tm1851 | |||||
---|---|---|---|---|---|---|---|---|
Other_name (16) | ||||||||
HGVSg | CHROMOSOME_IV:g.6167397_6168609del | |||||||
Sequence_details | SMap | S_parent | Sequence | C11D2 | ||||
Flanking_sequences | ttcaattcaaaaaatgttttgatattttct | tccgaaatccttcatccaacgtaacctcct | ||||||
Mapping_target | C11D2 | |||||||
Source_location | 7 | CHROMOSOME_IV | 6167396 | 6168610 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm1851_external | |||||||
tm1851_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1851 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00166025 | ||||||
WBGene00048846 | ||||||||
WBGene00165191 | ||||||||
WBGene00168875 | ||||||||
WBGene00171586 | ||||||||
WBGene00006809 | ||||||||
Transcript | C11D2.6b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | C11D2.6b.1:c.1004_1588-138del | |||||||
cDNA_position | 1004-? | |||||||
CDS_position | 1004-? | |||||||
Protein_position | 335-? | |||||||
Intron_number | 7-8/26 | |||||||
Exon_number | 7-8/27 | |||||||
C11D2.6i.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C11D2.6i.1:c.1148_1732-138del | |||||||
cDNA_position | 1148-? | |||||||
CDS_position | 1148-? | |||||||
Protein_position | 383-? | |||||||
Intron_number | 8-9/28 | |||||||
Exon_number | 8-9/29 | |||||||
C11D2.6a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C11D2.6a.1:c.1184_1768-138del | |||||||
cDNA_position | 1287-? | |||||||
CDS_position | 1184-? | |||||||
Protein_position | 395-? | |||||||
Intron_number | 9-10/29 | |||||||
Exon_number | 9-10/30 | |||||||
C11D2.74 | ||||||||
C11D2.6l.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C11D2.6l.1:c.1148_1732-138del | |||||||
cDNA_position | 1148-? | |||||||
CDS_position | 1148-? | |||||||
Protein_position | 383-? | |||||||
Intron_number | 8-9/27 | |||||||
Exon_number | 8-9/28 | |||||||
C11D2.6e.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C11D2.6e.1:c.1184_1768-138del | |||||||
cDNA_position | 1184-? | |||||||
CDS_position | 1184-? | |||||||
Protein_position | 395-? | |||||||
Intron_number | 8-9/27 | |||||||
Exon_number | 8-9/28 | |||||||
C11D2.6g.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C11D2.6g.1:c.1184_1768-138del | |||||||
cDNA_position | 1184-? | |||||||
CDS_position | 1184-? | |||||||
Protein_position | 395-? | |||||||
Intron_number | 8-9/27 | |||||||
Exon_number | 8-9/28 | |||||||
C11D2.43 | ||||||||
C11D2.6m.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C11D2.6m.1:c.1202_1786-138del | |||||||
cDNA_position | 1202-? | |||||||
CDS_position | 1202-? | |||||||
Protein_position | 401-? | |||||||
Intron_number | 9-10/29 | |||||||
Exon_number | 9-10/30 | |||||||
C11D2.6k.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C11D2.6k.1:c.1148_1732-138del | |||||||
cDNA_position | 1148-? | |||||||
CDS_position | 1148-? | |||||||
Protein_position | 383-? | |||||||
Intron_number | 8-9/27 | |||||||
Exon_number | 8-9/28 | |||||||
C11D2.6o.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C11D2.6o.1:c.1202_1786-138del | |||||||
cDNA_position | 1202-? | |||||||
CDS_position | 1202-? | |||||||
Protein_position | 401-? | |||||||
Intron_number | 9-10/28 | |||||||
Exon_number | 9-10/29 | |||||||
C11D2.6p.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C11D2.6p.1:c.1202_1786-138del | |||||||
cDNA_position | 1202-? | |||||||
CDS_position | 1202-? | |||||||
Protein_position | 401-? | |||||||
Intron_number | 9-10/28 | |||||||
Exon_number | 9-10/29 | |||||||
C11D2.31 | ||||||||
C11D2.6f.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C11D2.6f.1:c.1004_1588-138del | |||||||
cDNA_position | 1004-? | |||||||
CDS_position | 1004-? | |||||||
Protein_position | 335-? | |||||||
Intron_number | 7-8/25 | |||||||
Exon_number | 7-8/26 | |||||||
C11D2.49 | ||||||||
C11D2.6d.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C11D2.6d.1:c.1184_1768-138del | |||||||
cDNA_position | 1184-? | |||||||
CDS_position | 1184-? | |||||||
Protein_position | 395-? | |||||||
Intron_number | 8-9/28 | |||||||
Exon_number | 8-9/29 | |||||||
C11D2.6c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C11D2.6c.1:c.1004_1588-138del | |||||||
cDNA_position | 1004-? | |||||||
CDS_position | 1004-? | |||||||
Protein_position | 335-? | |||||||
Intron_number | 7-8/28 | |||||||
Exon_number | 7-8/29 | |||||||
C11D2.6h.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C11D2.6h.1:c.1004_1588-138del | |||||||
cDNA_position | 1004-? | |||||||
CDS_position | 1004-? | |||||||
Protein_position | 335-? | |||||||
Intron_number | 7-8/26 | |||||||
Exon_number | 7-8/27 | |||||||
C11D2.6n.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C11D2.6n.1:c.1202_1786-138del | |||||||
cDNA_position | 1202-? | |||||||
CDS_position | 1202-? | |||||||
Protein_position | 401-? | |||||||
Intron_number | 9-10/27 | |||||||
Exon_number | 9-10/28 | |||||||
C11D2.6j.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C11D2.6j.1:c.1148_1732-138del | |||||||
cDNA_position | 1148-? | |||||||
CDS_position | 1148-? | |||||||
Protein_position | 383-? | |||||||
Intron_number | 8-9/26 | |||||||
Exon_number | 8-9/27 | |||||||
C11D2.62 | ||||||||
Interactor | WBInteraction000503537 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | IV | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 19547/19548-20760/20761 (1213 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |