WormBase Tree Display for Variation: WBVar00089461
expand all nodes | collapse all nodes | view schema
WBVar00089461 | Evidence | Person_evidence | WBPerson23830 | |||
---|---|---|---|---|---|---|
Name | Public_name | n372 | ||||
Other_name | CE26703:p.Glu30Lys | |||||
Y54G2A.1.1:c.88G>A | ||||||
HGVSg | CHROMOSOME_IV:g.3019924G>A | |||||
Sequence_details | SMap | S_parent | Sequence | Y54G2A | ||
Flanking_sequences | caacattttcagaaaaacaaacctctaatg | agaagaaacggagagctcgaataaacaagt | ||||
Mapping_target | Y54G2A | |||||
Type_of_mutation | Substitution | g | a | |||
SeqStatus | Sequenced | |||||
Variation_type | Allele | |||||
Origin | Species | Caenorhabditis elegans | ||||
Strain | WBStrain00004555 | |||||
WBStrain00004801 | ||||||
WBStrain00004805 | ||||||
WBStrain00004806 | ||||||
WBStrain00026726 | ||||||
Laboratory | MT | |||||
Status | Live | |||||
Affects | Gene | WBGene00003008 | ||||
Transcript | Y54G2A.1.1 | VEP_consequence | missense_variant | |||
VEP_impact | MODERATE | |||||
SIFT | 0 | deleterious | ||||
PolyPhen | 1 | probably_damaging | ||||
HGVSc | Y54G2A.1.1:c.88G>A | |||||
HGVSp | CE26703:p.Glu30Lys | |||||
cDNA_position | 90 | |||||
CDS_position | 88 | |||||
Protein_position | 30 | |||||
Exon_number | 3/5 | |||||
Codon_change | Gag/Aag | |||||
Amino_acid_change | E/K | |||||
Genetics | Interpolated_map_position | IV | -6.65615 | |||
Mapping_data | In_multi_point | 683 | ||||
684 | ||||||
691 | ||||||
Description (2) | ||||||
Reference | WBPaper00006052 | |||||
WBPaper00022140 | ||||||
WBPaper00013704 | ||||||
WBPaper00001576 | ||||||
WBPaper00014771 | ||||||
WBPaper00016173 | ||||||
WBPaper00016309 | ||||||
WBPaper00013803 | ||||||
WBPaper00016477 | ||||||
WBPaper00056582 | ||||||
Remark | alt_det = g to a mut_det = E(30)K | Person_evidence | WBPerson23830 | |||
Curator_confirmed | WBPerson51134 | |||||
Sequence data from The role of lin-22, a hairy/Enhancer of split homolog, in patterning the peripheral nervous system of C. elegans, Lisa A. Wrischnik and Cynthia J. Kenyon, Development, 1997 | Person_evidence | WBPerson23830 | ||||
Curator_confirmed | WBPerson51134 | |||||
Variation information submitted by WBPerson23830 on 2021-05-7_10:00:52 via the Allele submission form. | Curator_confirmed | WBPerson51134 | ||||
Method | Substitution_allele |