WormBase Tree Display for Variation: WBVar00000230
expand all nodes | collapse all nodes | view schema
WBVar00000230 | Evidence | Paper_evidence | WBPaper00005695 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ar202 | |||||||
Other_name | CE00237:p.Gly529Glu | ||||||||
F02A9.6.1:c.1586G>A | |||||||||
HGVSg | CHROMOSOME_III:g.9096522G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F02A9 | |||||
Flanking_sequences | gtaattttgatggaggtgattgctcaggag | gcaaagaccattctccaaatgtcaataccc | |||||||
Mapping_target | F02A9 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (4) | |||||||||
Affects | Gene | WBGene00001609 | |||||||
Transcript | F02A9.6.1 (12) | ||||||||
Interactor (40) | |||||||||
Genetics | Interpolated_map_position | III | 0.163806 | ||||||
Description | Phenotype | WBPhenotype:0000038 | Paper_evidence | WBPaper00050044 | |||||
Curator_confirmed | WBPerson17144 | ||||||||
Remark | Increase rupture post-reproductively | Paper_evidence | WBPaper00050044 | ||||||
Curator_confirmed | WBPerson17144 | ||||||||
WBPhenotype:0000050 | Paper_evidence | WBPaper00040544 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | temperature-sensitive mutation that causes embryonic lethality at its restrictive temperature | Paper_evidence | WBPaper00040544 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
temperature-sensitive hyperactive mutation that causes embryonic lethality at its restrictive temperature | Paper_evidence | WBPaper00040544 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00040544 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000315 | Paper_evidence | WBPaper00038400 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals had a higher arousal threshold to mechanosensory stimuli than control animals; animals responded less frequently to stimuli than control quiescent animals. | Paper_evidence | WBPaper00038400 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Gain_of_function_undetermined_type | Paper_evidence | WBPaper00038400 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00038400 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00040544 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00040544 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000823 | Paper_evidence | WBPaper00032182 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals displayed germ cell over-proliferation. | Paper_evidence | WBPaper00032182 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function (2) | ||||||||
WBPhenotype:0001038 | Paper_evidence | WBPaper00032182 | |||||||
WBPaper00034675 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Penetrance | High | 90-99% | Paper_evidence | WBPaper00034675 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Hypermorph_gain_of_function (2) | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00034675 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00034675 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Genotype | glp-1(ar202) III | Paper_evidence | WBPaper00034675 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001184 | Paper_evidence | WBPaper00032310 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | glp-1(ar202gf) mutants with a hyperactive GLP-1 showed a factor of 1.7 fat increase (Figure 2H,I,K) | Paper_evidence | WBPaper00032310 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Hypermorph_gain_of_function (2) | ||||||||
WBPhenotype:0001408 | Paper_evidence | WBPaper00034719 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | There is also an increase in distal METT-10 levels when the glp-1(ar202) gain-of-function mutant is shifted to 25C to induce tumors | Paper_evidence | WBPaper00034719 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypermorph_gain_of_function (2) | ||||||||
Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00034719 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001524 | Paper_evidence | WBPaper00038400 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited increased L4/A quiescence compared to control animals. | Paper_evidence | WBPaper00038400 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Gain_of_function_undetermined_type | Paper_evidence | WBPaper00038400 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00038400 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000136 | Paper_evidence | WBPaper00031962 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Levels of prg-1 mRNA were similar to that measured in wild-type animals, as assayed by qRT-PCR. | Paper_evidence | WBPaper00031962 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function (2) | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00031962 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00031962 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000412 | Paper_evidence | WBPaper00038400 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals responded to octanol like control animals, regardless of temperature. | Paper_evidence | WBPaper00038400 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Gain_of_function_undetermined_type | Paper_evidence | WBPaper00038400 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00001966 | Paper_evidence | WBPaper00038400 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00038400 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000641 | Paper_evidence | WBPaper00038400 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals did not exhibit a significant difference in basal locomotion activity compared to control animals. | Paper_evidence | WBPaper00038400 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Gain_of_function_undetermined_type | Paper_evidence | WBPaper00038400 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00038400 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001759 | Paper_evidence | WBPaper00031962 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 21UR-1 levels were unchanged in glp-1(ar202gf,ts) mutants at the restrictive temperature compared to control animals. | Paper_evidence | WBPaper00031962 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function (2) | ||||||||
EQ_annotations | GO_term | GO:0034585 | PATO:0000460 | Paper_evidence | WBPaper00031962 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00031962 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00031962 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (15) | |||||||||
Remark | G529E,extracellular domain | ||||||||
Method | Substitution_allele |