WormBase Tree Display for Variation: WBVar00000249
expand all nodes | collapse all nodes | view schema
WBVar00000249 | Evidence | Paper_evidence | WBPaper00004883 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ar472 | ||||||
Other_name | CE53317:p.Trp189Ter | |||||||
C25B8.7.1:c.567G>A | ||||||||
HGVSg | CHROMOSOME_X:g.6630112C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | C25B8 | ||||
Flanking_sequences | ctcaaatttcagttttgcgacatactactg | atgtatagttatatgtactttgtaaatgca | ||||||
Mapping_target | C25B8 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00050677 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00008042 | |||||||
Laboratory | GS | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00000850 | ||||||
WBGene00016090 | ||||||||
Transcript | C25B8.7.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | C25B8.7.1:c.567G>A | |||||||
HGVSp | CE53317:p.Trp189Ter | |||||||
cDNA_position | 636 | |||||||
CDS_position | 567 | |||||||
Protein_position | 189 | |||||||
Exon_number | 7/14 | |||||||
Codon_change | tgG/tgA | |||||||
Amino_acid_change | W/* | |||||||
Genetics | Interpolated_map_position | X | -2.67897 | |||||
Description | Phenotype | WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibited an accumulation of several vesicles that are full of GFP and indistinguishable from the wild-type profile at the level of analysis. | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | dpy-20(e1282); arIs37[pmyo-3::ssGFP] | Paper_evidence | WBPaper00004883 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000643 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals had normal movement. | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | dpy-20(e1282); arIs37[pmyo-3::ssGFP] | Paper_evidence | WBPaper00004883 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00004883 | |||||||
WBPaper00050677 | ||||||||
Method | Substitution_allele |