WormBase Tree Display for Variation: WBVar00000414
expand all nodes | collapse all nodes | view schema
| WBVar00000414 | Evidence | Paper_evidence | WBPaper00003831 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | b1008 | |||||
| Other_name | T11F8.3a.1:c.1318delinsTG | ||||||
| CE49356:p.Ile361CysfsTer3 | |||||||
| CE22368:p.Ile440CysfsTer3 | |||||||
| T11F8.3b.1:c.1081delinsTG | |||||||
| HGVSg | CHROMOSOME_IV:g.5471441delinsTG | ||||||
| Sequence_details | SMap | S_parent | Sequence | T11F8 | |||
| Flanking_sequences | atgcatcgcaacaacaaaatgttcatgtca | tctgatgagcacggtgatccaactggcgaa | |||||
| Mapping_target | T11F8 | ||||||
| Type_of_mutation | Substitution | att | tgtt | Paper_evidence | WBPaper00003831 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00005828 | ||||||
| Laboratory | DH | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00004374 | |||||
| Transcript | T11F8.3b.1 | VEP_consequence | frameshift_variant | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | T11F8.3b.1:c.1081delinsTG | ||||||
| HGVSp | CE49356:p.Ile361CysfsTer3 | ||||||
| cDNA_position | 1081-1083 | ||||||
| CDS_position | 1081-1083 | ||||||
| Protein_position | 361 | ||||||
| Exon_number | 2/6 | ||||||
| Codon_change | ATT/TGTT | ||||||
| Amino_acid_change | I/CX | ||||||
| T11F8.3a.1 | VEP_consequence | frameshift_variant | |||||
| VEP_impact | HIGH | ||||||
| HGVSc | T11F8.3a.1:c.1318delinsTG | ||||||
| HGVSp | CE22368:p.Ile440CysfsTer3 | ||||||
| cDNA_position | 1321-1323 | ||||||
| CDS_position | 1318-1320 | ||||||
| Protein_position | 440 | ||||||
| Exon_number | 4/9 | ||||||
| Codon_change | ATT/TGTT | ||||||
| Amino_acid_change | I/CX | ||||||
| Interactor | WBInteraction000502376 | ||||||
| WBInteraction000521457 | |||||||
| Genetics | Interpolated_map_position | IV | 1.68689 | ||||
| Description | Phenotype (13) | ||||||
| Phenotype_not_observed | WBPhenotype:0000029 | Paper_evidence | WBPaper00051563 | ||||
| Curator_confirmed | WBPerson38351 | ||||||
| Remark | Responds to RNAi similarly to wild type | Paper_evidence | WBPaper00051563 | ||||
| Curator_confirmed | WBPerson38351 | ||||||
| WBPhenotype:0000812 | Paper_evidence | WBPaper00003831 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Animals exhibited normal germ line morphology. | Paper_evidence | WBPaper00003831 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00003831 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00003831 | ||||||
| WBPaper00027612 | |||||||
| WBPaper00028527 | |||||||
| WBPaper00051563 | |||||||
| Method | Substitution_allele |
