WormBase Tree Display for Variation: WBVar00000416
expand all nodes | collapse all nodes | view schema
WBVar00000416 | Evidence | Paper_evidence | WBPaper00025193 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | b1014 | ||||||
Other_name | F49E7.1a.1:c.970C>T | |||||||
F49E7.1b.2:c.-2103C>T | ||||||||
F49E7.1b.1:c.-2028C>T | ||||||||
CE38712:p.Gln324Ter | ||||||||
HGVSg | CHROMOSOME_X:g.1098971C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | F49E7 | ||||
Flanking_sequences | aacctcatttgcccggcaatcatcagtccg | aaaagtttggagttgtggataatgatgtca | ||||||
Mapping_target | F49E7 | |||||||
Type_of_mutation | Substitution | c | t | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00005827 | |||||||
Laboratory | DH | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00004377 | ||||||
Transcript | F49E7.1b.2 | VEP_consequence | 5_prime_UTR_variant | |||||
VEP_impact | MODIFIER | |||||||
HGVSc | F49E7.1b.2:c.-2103C>T | |||||||
cDNA_position | 38 | |||||||
Exon_number | 1/13 | |||||||
F49E7.1a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F49E7.1a.1:c.970C>T | |||||||
HGVSp | CE38712:p.Gln324Ter | |||||||
cDNA_position | 974 | |||||||
CDS_position | 970 | |||||||
Protein_position | 324 | |||||||
Exon_number | 8/20 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
F49E7.1b.1 | VEP_consequence | 5_prime_UTR_variant | ||||||
VEP_impact | MODIFIER | |||||||
HGVSc | F49E7.1b.1:c.-2028C>T | |||||||
cDNA_position | 870 | |||||||
Exon_number | 6/19 | |||||||
Interactor | WBInteraction000518623 | |||||||
Genetics | Interpolated_map_position | X | -18.7272 | |||||
Description | Phenotype | WBPhenotype:0000256 | Paper_evidence | WBPaper00048972 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "The only GDI homologue in C_elegans, gdi-1, as well as rab-5 are essential genes, therefore we could not test whether loss of either of these genes suppresses gpa-3QL(syIs25). Instead, we tested whether mutations in the GEFs rabx-5 and rme-6 and the GAP tbc-2, which activate and inactivate RAB-5 respectively, are suppressors. Interestingly, rabx-5(ok1763); gpa-3QL(syIs25) animals are dye-filling, indicating that rabx-5(ok1763) is a suppressor of gpa-3QL(syIs25) (Fig 5A). Cilium length measurements showed that mutation of rabx-5 significantly restored cilium length in gpa-3QL(syIs25) animals (Fig 5C). Also rme-6(b1014), the other RAB-5 GEF, suppressed the gpa-3QL induced dye filling defect (Fig 5B). Mutation of the RAB-5 GAP, tbc-2 (tm2241), did not suppress the gpa-3QL dye filling defect (Fig 5A)." | Paper_evidence | WBPaper00048972 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | gpa-3QL(syIs25) | Paper_evidence | WBPaper00048972 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00038458 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00048972 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "First, we analyzed whether GFP::RAB-5 localization was affected by mutation of its GEFs or GAP. Mutation of the RAB-5 GEF rme-6 resulted in increased GFP::RAB-5 levels, whereas mutation of rabx-5 only slightly affected GFP::RAB-5 levels, although quantification of the fluorescence intensities did not reveal a significant difference between wild type and rme-6 or rabx-5 animals (Fig 6B and 6C). Inactivation of the RAB-5 GAP in tbc-2(tm2241) animals did not affect GFP::RAB-5 levels (Fig 6B and 6C)." | Paper_evidence | WBPaper00048972 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | GFP::RAB-5 | Paper_evidence | WBPaper00048972 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0010004 | Paper_evidence | WBPaper00031805 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutant worms did not show any defects in corpse removal | Paper_evidence | WBPaper00031805 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00038458 | |||||||
WBPaper00031805 | ||||||||
WBPaper00048972 | ||||||||
Method | Substitution_allele |