WormBase Tree Display for Variation: WBVar00000423
expand all nodes | collapse all nodes | view schema
| WBVar00000423 | Evidence | Paper_evidence | WBPaper00032503 | ||
|---|---|---|---|---|---|
| Name | Public_name | b1024 | |||
| Sequence_details | SMap | S_parent | Sequence | T20G5 | |
| Flanking_sequences | aggtgcgctatgagtcctcaaaaatttttcttt | ctcagcaaagagttctaacttttggaattac | |||
| Mapping_target | T20G5 | ||||
| Type_of_mutation | Insertion | ||||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Transposon_insertion | Tc5 | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Laboratory | DH | ||||
| Status | Live | ||||
| Possibly_affects | WBGene00011867 | ||||
| Genetics | Interpolated_map_position | III | 2.01084 | ||
| Reference | WBPaper00032503 | ||||
| Remark | A 3kb Tc5 transposable element in the predicted promoter region of chc-1, 292 bases upstream of the predicted start codon. | ||||
| Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00011867 Genomic_neighbourhood | |||||
| Method | Transposon_insertion |
