WormBase Tree Display for Variation: WBVar00000465
expand all nodes | collapse all nodes | view schema
WBVar00000465 | Evidence | Paper_evidence | WBPaper00028483 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | bn23 | |||||||
Other_name | Y2H9A.1.1:c.2173-1G>A | ||||||||
HGVSg | CHROMOSOME_V:g.13434384C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y2H9A | |||||
Flanking_sequences | tcaacattttgattttatttcttattttca | gccggaaagaacggaaccgcatctaagaaa | |||||||
Mapping_target | Y2H9A | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00028483 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00034440 | ||||||||
Laboratory | SS | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003222 | |||||||
Transcript | Y2H9A.1.1 | VEP_consequence | splice_acceptor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y2H9A.1.1:c.2173-1G>A | ||||||||
Intron_number | 8/11 | ||||||||
Interactor | WBInteraction000050871 | ||||||||
WBInteraction000050877 | |||||||||
WBInteraction000050883 | |||||||||
WBInteraction000050886 | |||||||||
WBInteraction000050890 | |||||||||
WBInteraction000502764 | |||||||||
WBInteraction000541585 | |||||||||
Genetics | Interpolated_map_position | V | 5.33953 | ||||||
Mapping_data | In_2_point | 6090 | |||||||
6092 | |||||||||
6093 | |||||||||
6094 | |||||||||
6095 | |||||||||
6096 | |||||||||
6097 | |||||||||
6098 | |||||||||
In_multi_point | 2157 | ||||||||
2161 | |||||||||
2162 | |||||||||
2163 | |||||||||
2164 | |||||||||
2165 | |||||||||
2166 | |||||||||
In_pos_neg_data | 6685 | ||||||||
6686 | |||||||||
Description | Phenotype | WBPhenotype:0000154 | Paper_evidence | WBPaper00001477 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | bn23 homozygous mothers have a reduced average brood size compared to wild-type controls | Paper_evidence | WBPaper00001477 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001477 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001477 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 16 C , 25 C | Paper_evidence | WBPaper00001477 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000684 | Paper_evidence | WBPaper00001477 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutant progeny exhibit abnormal germline proliferation during development and fail to form mature gametes | Paper_evidence | WBPaper00001477 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001477 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001477 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00001477 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001504 | Paper_evidence | WBPaper00001477 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mes phenotype is not due to abnormalities in P granule staining | Paper_evidence | WBPaper00001477 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00001477 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Range | 100 | 100 | Paper_evidence | WBPaper00001477 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001477 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001477 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00001477 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 16 C , 25 C | Paper_evidence | WBPaper00001477 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000052 | Paper_evidence | WBPaper00001477 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001477 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00001477 | ||||||||
WBPaper00014214 | |||||||||
Method | Substitution_allele |