WormBase Tree Display for Variation: WBVar00000475
expand all nodes | collapse all nodes | view schema
WBVar00000475 | Evidence | Paper_evidence | WBPaper00005019 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | bn53 | |||||||
Other_name | F54C1.3a.1:c.1307G>A | ||||||||
CE53747:p.Trp417Ter | |||||||||
F54C1.3a.2:c.1307G>A | |||||||||
CE11046:p.Trp436Ter | |||||||||
F54C1.3b.1:c.1250G>A | |||||||||
HGVSg | CHROMOSOME_I:g.5000323G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F54C1 | |||||
Flanking_sequences | agagacatttgacccgactcacttcaagat | gccgtgtttttcagtcgatccgacgaaggt | |||||||
Mapping_target | F54C1 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | SS | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003221 | |||||||
Transcript | F54C1.3a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F54C1.3a.1:c.1307G>A | ||||||||
HGVSp | CE11046:p.Trp436Ter | ||||||||
cDNA_position | 1312 | ||||||||
CDS_position | 1307 | ||||||||
Protein_position | 436 | ||||||||
Exon_number | 11/17 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
F54C1.3b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F54C1.3b.1:c.1250G>A | ||||||||
HGVSp | CE53747:p.Trp417Ter | ||||||||
cDNA_position | 1259 | ||||||||
CDS_position | 1250 | ||||||||
Protein_position | 417 | ||||||||
Exon_number | 10/16 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
F54C1.3a.2 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F54C1.3a.2:c.1307G>A | ||||||||
HGVSp | CE11046:p.Trp436Ter | ||||||||
cDNA_position | 1312 | ||||||||
CDS_position | 1307 | ||||||||
Protein_position | 436 | ||||||||
Exon_number | 11/18 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
Genetics | Interpolated_map_position | I | -0.428809 | ||||||
Mapping_data | In_2_point | 6042 | |||||||
In_multi_point | 2094 | ||||||||
Description | Phenotype | WBPhenotype:0000154 | Paper_evidence | WBPaper00001477 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Homozygous mothers have a reduced average brood size compared to wild-type controls | Paper_evidence | WBPaper00001477 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001477 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001477 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001477 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 16 C , 25 C | Paper_evidence | WBPaper00001477 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000684 | Paper_evidence | WBPaper00001477 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutant progeny exhibit abnormal germline proliferation during development and fail to form mature gametes | Paper_evidence | WBPaper00001477 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001477 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001477 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001477 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00001477 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001037 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Stronger allele than bn35. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001504 | Paper_evidence | WBPaper00001477 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mes phenotype is not due to abnormalities in P granule staining | Paper_evidence | WBPaper00001477 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00001477 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Range | 100 | 100 | Paper_evidence | WBPaper00001477 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001477 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001477 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001477 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00001477 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 16 C , 25 C | Paper_evidence | WBPaper00001477 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000052 | Paper_evidence | WBPaper00001477 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001477 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001477 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00001477 | ||||||||
WBPaper00014393 | |||||||||
Method | Substitution_allele |