WormBase Tree Display for Variation: WBVar00000477
expand all nodes | collapse all nodes | view schema
WBVar00000477 | Evidence | Paper_evidence | WBPaper00028483 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | bn58 | |||||||
Other_name | CE27781:p.Arg389Cys | ||||||||
Y2H9A.1.1:c.1165C>T | |||||||||
HGVSg | CHROMOSOME_V:g.13436152G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y2H9A | |||||
Flanking_sequences | ctcgattggtacaagtaccctactggaaat | gtggtaatatcaactttgaacgtcttggat | |||||||
Mapping_target | Y2H9A | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00028483 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | SS | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003222 | |||||||
Transcript | Y2H9A.1.1 (12) | ||||||||
Genetics | Interpolated_map_position | V | 5.34431 | ||||||
Mapping_data | In_multi_point | 2159 | |||||||
In_pos_neg_data | 6687 | ||||||||
Description | Phenotype | WBPhenotype:0000154 | Paper_evidence | WBPaper00001477 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | bn58 homozygous mothers have a reduced average brood size compared to wild-type controls | Paper_evidence | WBPaper00001477 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001477 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001477 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 16 C , 25 C | Paper_evidence | WBPaper00001477 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000684 | Paper_evidence | WBPaper00001477 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutant progeny exhibit abnormal germline proliferation during development and fail to form mature gametes | Paper_evidence | WBPaper00001477 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001477 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001477 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | |||||||||
WBPhenotype:0001504 | Paper_evidence | WBPaper00001477 | |||||||
WBPaper00037131 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson13811 | |||||||||
Remark | Mes phenotype is not due to abnormalities in P granule staining | Paper_evidence | WBPaper00001477 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance (2) | |||||||||
Recessive | Paper_evidence | WBPaper00001477 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001477 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | |||||||||
Phenotype_assay | Temperature | 16 C , 25 C | Paper_evidence | WBPaper00001477 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000052 | Paper_evidence | WBPaper00001477 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001477 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00001477 | ||||||||
WBPaper00037131 | |||||||||
Method | Substitution_allele |