WormBase Tree Display for Variation: WBVar00000490
expand all nodes | collapse all nodes | view schema
| WBVar00000490 | Evidence | Paper_evidence | WBPaper00005019 | |||
|---|---|---|---|---|---|---|
| Name | Public_name | bn88 | ||||
| Other_name | F54C1.3a.1:c.1978A>T | |||||
| F54C1.3b.1:c.1921A>T | ||||||
| F54C1.3a.2:c.1978A>T | ||||||
| CE53747:p.Thr641Ser | ||||||
| CE11046:p.Thr660Ser | ||||||
| HGVSg | CHROMOSOME_I:g.5001786A>T | |||||
| Sequence_details | SMap | S_parent | Sequence | F54C1 | ||
| Flanking_sequences | ttttcagaaatattcttcccaagtggaaaa | ctgaactattcaatattctatgcagacagt | ||||
| Mapping_target | F54C1 | |||||
| Type_of_mutation | Substitution | a | t | |||
| SeqStatus | Sequenced | |||||
| Variation_type | Allele | |||||
| Origin | Species | Caenorhabditis elegans | ||||
| Laboratory | SS | |||||
| Status | Live | |||||
| Affects | Gene | WBGene00003221 | ||||
| Transcript | F54C1.3a.1 | VEP_consequence | missense_variant | |||
| VEP_impact | MODERATE | |||||
| SIFT | 0.77 | tolerated_low_confidence | ||||
| PolyPhen | 0.272 | benign | ||||
| HGVSc | F54C1.3a.1:c.1978A>T | |||||
| HGVSp | CE11046:p.Thr660Ser | |||||
| cDNA_position | 1983 | |||||
| CDS_position | 1978 | |||||
| Protein_position | 660 | |||||
| Exon_number | 14/17 | |||||
| Codon_change | Act/Tct | |||||
| Amino_acid_change | T/S | |||||
| F54C1.3b.1 | VEP_consequence | missense_variant | ||||
| VEP_impact | MODERATE | |||||
| SIFT | 0.78 | tolerated_low_confidence | ||||
| PolyPhen | 0.272 | benign | ||||
| HGVSc | F54C1.3b.1:c.1921A>T | |||||
| HGVSp | CE53747:p.Thr641Ser | |||||
| cDNA_position | 1930 | |||||
| CDS_position | 1921 | |||||
| Protein_position | 641 | |||||
| Exon_number | 13/16 | |||||
| Codon_change | Act/Tct | |||||
| Amino_acid_change | T/S | |||||
| F54C1.3a.2 | VEP_consequence | missense_variant | ||||
| VEP_impact | MODERATE | |||||
| SIFT | 0.77 | tolerated_low_confidence | ||||
| PolyPhen | 0.272 | benign | ||||
| HGVSc | F54C1.3a.2:c.1978A>T | |||||
| HGVSp | CE11046:p.Thr660Ser | |||||
| cDNA_position | 1983 | |||||
| CDS_position | 1978 | |||||
| Protein_position | 660 | |||||
| Exon_number | 14/18 | |||||
| Codon_change | Act/Tct | |||||
| Amino_acid_change | T/S | |||||
| Interactor | WBInteraction000557641 | |||||
| Genetics | Interpolated_map_position | I | -0.428729 | |||
| Mapping_data | In_multi_point | 2095 | ||||
| Reference | WBPaper00005019 | |||||
| Remark | This substitution is coupled with a downstream deletion of a4945 causing a frameshift at T660 | Paper_evidence | WBPaper00005019 | |||
| Method | Substitution_allele |
