WormBase Tree Display for Variation: WBVar00000493
expand all nodes | collapse all nodes | view schema
WBVar00000493 | Evidence | Paper_evidence | WBPaper00003186 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name (3) | |||||||||
Sequence_details | SMap | S_parent | Sequence | ZK381 | |||||
Flanking_sequences | tctgttgggaaagttgtgaaccatatcgct | aacttttcgaggaagcgagtaaaaatgaag | |||||||
Mapping_target | ZK381 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003186 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00034442 | ||||||||
WBStrain00034447 | |||||||||
WBStrain00034454 | |||||||||
WBStrain00034456 | |||||||||
WBStrain00040437 | |||||||||
Laboratory | SS | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003992 | |||||||
Transcript | ZK381.4b.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK381.4b.1:c.844C>T | ||||||||
HGVSp | CE07628:p.Gln282Ter | ||||||||
cDNA_position | 844 | ||||||||
CDS_position | 844 | ||||||||
Protein_position | 282 | ||||||||
Exon_number | 5/9 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
ZK381.4a.2 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK381.4a.2:c.721C>T | ||||||||
HGVSp | CE25689:p.Gln241Ter | ||||||||
cDNA_position | 775 | ||||||||
CDS_position | 721 | ||||||||
Protein_position | 241 | ||||||||
Exon_number | 6/11 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
ZK381.4a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK381.4a.1:c.721C>T | ||||||||
HGVSp | CE25689:p.Gln241Ter | ||||||||
cDNA_position | 736 | ||||||||
CDS_position | 721 | ||||||||
Protein_position | 241 | ||||||||
Exon_number | 5/10 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor | WBInteraction000502232 | ||||||||
WBInteraction000549004 | |||||||||
WBInteraction000549006 | |||||||||
Genetics | Interpolated_map_position | IV | 3.25696 | ||||||
Description | Phenotype | WBPhenotype:0001036 | Paper_evidence | WBPaper00003186 | |||||
Curator_confirmed | WBPerson1148 | ||||||||
Remark | Figure 5 | Paper_evidence | WBPaper00003186 | ||||||
Curator_confirmed | WBPerson1148 | ||||||||
Temperature_sensitive | Heat_sensitive | 26 | Paper_evidence | WBPaper00003186 | |||||
Curator_confirmed | WBPerson1148 | ||||||||
Phenotype_not_observed | WBPhenotype:0000436 | Paper_evidence | WBPaper00031440 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | MEG-1 localized to P granules in pgl-1 mutants as in wild type | Paper_evidence | WBPaper00031440 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00031440 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Antibody staining to MEG-1 | Paper_evidence | WBPaper00031440 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00031440 | ||||||||
WBPaper00003186 | |||||||||
Method | Substitution_allele |