WormBase Tree Display for Variation: WBVar00000499
expand all nodes | collapse all nodes | view schema
| WBVar00000499 | Evidence | Person_evidence | WBPerson616 | |||||
|---|---|---|---|---|---|---|---|---|
| Name | Public_name | bn121 | ||||||
| Other_name | CE49430:p.Met201IlefsTer2 | |||||||
| Y65B4BL.2a.1:c.737_921del | ||||||||
| Y65B4BL.2b.1:c.602_786del | ||||||||
| CE25536:p.Met246IlefsTer2 | ||||||||
| HGVSg | CHROMOSOME_I:g.507464_507648del | |||||||
| Sequence_details | SMap | S_parent | Sequence | Y65B4BL | ||||
| Flanking_sequences | TTGACAATTTGATTTTGCAGGTCATCAAGA | TATGAGCTTCAGCCAGTTCCACTTCTCAGAC | ||||||
| Mapping_target | Y65B4BL | |||||||
| Type_of_mutation | Deletion | |||||||
| SeqStatus | Sequenced | |||||||
| Variation_type | Allele | |||||||
| Origin | Species | Caenorhabditis elegans | ||||||
| Strain | WBStrain00034459 | |||||||
| Laboratory | SS | |||||||
| Status | Live | |||||||
| Affects (3) | ||||||||
| Isolation | Mutagen | EMS | Person_evidence | WBPerson616 | ||||
| Genetics | Interpolated_map_position | I | -18.9835 | |||||
| Description | Phenotype | WBPhenotype:0000154 | Person_evidence | WBPerson616 | ||||
| Curator_confirmed | WBPerson557 | |||||||
| Remark | reduced brood sizes and many dead eggs at 15-20C | Person_evidence | WBPerson616 | |||||
| Curator_confirmed | WBPerson557 | |||||||
| Phenotype_assay | Temperature | 20 | Person_evidence | WBPerson616 | ||||
| Curator_confirmed | WBPerson557 | |||||||
| WBPhenotype:0001408 | Person_evidence | WBPerson616 | ||||||
| Curator_confirmed | WBPerson557 | |||||||
| Remark | mislocalized GFP::PGL-1 | Person_evidence | WBPerson616 | |||||
| Curator_confirmed | WBPerson557 | |||||||
| Phenotype_assay | Temperature | 25 | Person_evidence | WBPerson616 | ||||
| Curator_confirmed | WBPerson557 | |||||||
| Genotype | pie-1::gfp::pgl-1 | Person_evidence | WBPerson616 | |||||
| Curator_confirmed | WBPerson557 | |||||||
| WBPhenotype:0001504 | Person_evidence | WBPerson616 | ||||||
| Curator_confirmed | WBPerson557 | |||||||
| Remark | approximately 92% sterile at 24.5 C | Person_evidence | WBPerson616 | |||||
| Curator_confirmed | WBPerson557 | |||||||
| Penetrance | Incomplete | Person_evidence | WBPerson616 | |||||
| Curator_confirmed | WBPerson557 | |||||||
| Recessive | Person_evidence | WBPerson616 | ||||||
| Curator_confirmed | WBPerson557 | |||||||
| Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson616 | ||||
| Curator_confirmed | WBPerson557 | |||||||
| Maternal | ||||||||
| Phenotype_assay | Temperature | 25 | Person_evidence | WBPerson616 | ||||
| Curator_confirmed | WBPerson557 | |||||||
| WBPhenotype:0001776 | Paper_evidence | WBPaper00035324 | ||||||
| Curator_confirmed | WBPerson2021 | |||||||
| Remark | The expression of a 26G RNA (26G-S4) is dramatically reduced when its target deps-1 is mutated | Paper_evidence | WBPaper00035324 | |||||
| Curator_confirmed | WBPerson2021 | |||||||
| Reference | WBPaper00035324 | |||||||
| Method | Deletion_allele |
