WormBase Tree Display for Variation: WBVar00000575
expand all nodes | collapse all nodes | view schema
WBVar00000575 | Evidence | Paper_evidence | WBPaper00027716 | ||||||
---|---|---|---|---|---|---|---|---|---|
Person_evidence | WBPerson178 | ||||||||
Name | Public_name | bx37 | |||||||
Other_name | C12C8.3a.2:c.100G>A | ||||||||
CE27062:p.Gly34Arg | |||||||||
CE27063:p.Gly34Arg | |||||||||
C12C8.3a.1:c.100G>A | |||||||||
C12C8.3b.2:c.100G>A | |||||||||
C12C8.3b.1:c.100G>A | |||||||||
HGVSg | CHROMOSOME_I:g.9341798C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | C12C8 | |||||
Flanking_sequences | tgctgcttccgcccatcgacagctcgtttc | gctgtcgttggcgtccacgtcgatctcagt | |||||||
Mapping_target | C12C8 | ||||||||
Type_of_mutation | Substitution | C | T | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00007159 | ||||||||
Laboratory | EM | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003026 | |||||||
Transcript | C12C8.3b.1 (12) | ||||||||
C12C8.3a.1 (12) | |||||||||
C12C8.3b.2 (12) | |||||||||
C12C8.3a.2 (12) | |||||||||
Interactor | WBInteraction000503677 | ||||||||
WBInteraction000541130 | |||||||||
Isolation | Mutagen | EMS | |||||||
Genetics | Interpolated_map_position | I | 3.75274 | ||||||
Mapping_data | In_multi_point | 3194 | |||||||
3197 | |||||||||
3199 | |||||||||
Description | Phenotype | WBPhenotype:0000306 | Paper_evidence | WBPaper00031953 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | dmd-3::YFP expression was frequently absent from hyp10 in 33% mid-L4 males (n=35). | Paper_evidence | WBPaper00031953 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00031953 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00031953 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004378 | PATO:0000460 | Paper_evidence | WBPaper00031953 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000073 | PATO:0000460 | Paper_evidence | WBPaper00031953 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | fsEx154[DMD-3::YFP,cc::GFP] | Paper_evidence | WBPaper00031953 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001431 | Paper_evidence | WBPaper00027716 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | Male tail tip is pointy and protrudes beyond the posterior edge of the fan, 100% penetrant. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00027716 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Complete | 100% | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Range | 95 | 95 | Paper_evidence | WBPaper00027716 | |||||
Curator_confirmed | WBPerson48 | ||||||||
Semi_dominant | Paper_evidence | WBPaper00027716 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00027716 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00027716 | |||||
Curator_confirmed | WBPerson48 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00027716 | |||||
Curator_confirmed | WBPerson48 | ||||||||
Genotype | bx37; him-5(e1490) | Paper_evidence | WBPaper00027716 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Phenotype_not_observed | WBPhenotype:0000638 | Paper_evidence | WBPaper00027716 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000648 | Paper_evidence | WBPaper00027716 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000695 | Paper_evidence | WBPaper00027716 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001025 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No hermaphrodite phenotype. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001412 | Paper_evidence | WBPaper00027716 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Reference | WBPaper00027716 | ||||||||
WBPaper00031953 | |||||||||
WBPaper00020761 | |||||||||
WBPaper00014318 | |||||||||
WBPaper00019588 | |||||||||
WBPaper00015631 | |||||||||
WBPaper00010152 | |||||||||
WBPaper00026492 | |||||||||
WBPaper00023811 | |||||||||
Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | ||||||||
[200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | |||||||
Variation information submitted by on 2021-09-21_13:16:36 via the Allele submission form. Submitted data G/A refers to the negative strand sequence | Paper_evidence | WBPaper00027716 | |||||||
Person_evidence | WBPerson178 | ||||||||
Curator_confirmed | WBPerson51134 | ||||||||
Verified also by Julia Burnett (Hubbard lab), 9/21/2021. | Person_evidence | WBPerson178 | |||||||
Method | Substitution_allele |