WormBase Tree Display for Variation: WBVar00051562
expand all nodes | collapse all nodes | view schema
WBVar00051562 | Evidence | Paper_evidence | WBPaper00003138 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | cc561 | |||||||
Other_name | CE30067:p.Gln222Ter | ||||||||
B0304.1a.2:c.652C>T | |||||||||
B0304.1a.1:c.652C>T | |||||||||
CE02423:p.Gln222Ter | |||||||||
B0304.1b.1:c.664C>T | |||||||||
B0304.1c.1:c.664C>T | |||||||||
CE31766:p.Gln218Ter | |||||||||
HGVSg | CHROMOSOME_II:g.4521482C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | B0304 | |||||
Flanking_sequences | caagccggaaaaatgacaaagattatggag | agaaccagcatttgcagatgacacagcaga | |||||||
Mapping_target | B0304 | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00024340 | ||||||||
WBStrain00024341 | |||||||||
WBStrain00030583 | |||||||||
Component_of_genotype | WBGenotype00000012 | ||||||||
Laboratory | PD | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001948 | |||||||
Transcript | B0304.1a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0304.1a.1:c.652C>T | ||||||||
HGVSp | CE31766:p.Gln218Ter | ||||||||
cDNA_position | 656 | ||||||||
CDS_position | 652 | ||||||||
Protein_position | 218 | ||||||||
Exon_number | 4/8 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
B0304.1c.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0304.1c.1:c.664C>T | ||||||||
HGVSp | CE30067:p.Gln222Ter | ||||||||
cDNA_position | 670 | ||||||||
CDS_position | 664 | ||||||||
Protein_position | 222 | ||||||||
Exon_number | 4/8 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
B0304.1b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0304.1b.1:c.664C>T | ||||||||
HGVSp | CE02423:p.Gln222Ter | ||||||||
cDNA_position | 666 | ||||||||
CDS_position | 664 | ||||||||
Protein_position | 222 | ||||||||
Exon_number | 4/8 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
B0304.1a.2 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0304.1a.2:c.652C>T | ||||||||
HGVSp | CE31766:p.Gln218Ter | ||||||||
cDNA_position | 756 | ||||||||
CDS_position | 652 | ||||||||
Protein_position | 218 | ||||||||
Exon_number | 5/9 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor (13) | |||||||||
Genetics | Interpolated_map_position | II | -4.10405 | ||||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00025190 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00025190 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000053 | Paper_evidence | WBPaper00025190 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00025190 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000134 | Paper_evidence | WBPaper00064214 | |||||||
Curator_confirmed | WBPerson5063 | ||||||||
Remark | Reduced hlh-1 expression with age. | Paper_evidence | WBPaper00064214 | ||||||
Curator_confirmed | WBPerson5063 | ||||||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00025190 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | A large fraction of embryos that do hatch are Dpy. | Paper_evidence | WBPaper00025190 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00025190 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00025190 | |||||||
WBPaper00064214 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson5063 | |||||||||
Remark | A large fraction of embryos that do hatch are Unc. | Paper_evidence | WBPaper00025190 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Fig. 1 temperature-dependent UNC in animals shifted to 25C post-embryonic (L1-L3, but not L4) | Paper_evidence | WBPaper00064214 | |||||||
Curator_confirmed | WBPerson5063 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00025190 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000861 | Paper_evidence | WBPaper00025033 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Hermaphrodites heterozygous for the balanced hlh-1(cc450) null allele (Chen et al., 1992) were treated with mex-3, pop-1 double RNAi and progeny embryos collected. If HLH-1 was required for PAL-1 to induce muscle, 25% of the embryos (corresponding to the homozygous hlh-1(cc450) animals) should not respond to PAL-1. However, all treated embryos resulted in widespread body wall muscle-like myogenesis demonstrating that HLH-1 activity was not required for PAL-1-induced myogenesis (Fig. 7). We did notice that 22% (n=196) of the embryos showed less robust myogenesis, based on MHC A filament formation (Fig. 7B). These experiments were repeated using the temperature-sensitive hlh-1 allele cc561 (Harfe et al., 1998a), or hlh-1 RNAi for which the genotype of each embryo was unambiguous and the same results were obtained (Fig. 7C); myogenesis occurred but was not as robust in the absence of HLH-1." | Paper_evidence | WBPaper00025033 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | GO_term | GO:0007525 | PATO:0000460 | Paper_evidence | WBPaper00025033 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | mex-3, pop-1 double RNAi | Paper_evidence | WBPaper00025033 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001569 | Paper_evidence | WBPaper00064214 | |||||||
Curator_confirmed | WBPerson5063 | ||||||||
Remark | Fig. 1 temperature-dependent UNC in animals shifted to 25C post-embryonic. | Paper_evidence | WBPaper00064214 | ||||||
Curator_confirmed | WBPerson5063 | ||||||||
WBPhenotype:0002575 | Paper_evidence | WBPaper00064214 | |||||||
Curator_confirmed | WBPerson5063 | ||||||||
Remark | Some HLH-1-dependent genes are down-regulated, specifically under restrictive conditions, and are rescued by disrupting smg pathway. | Paper_evidence | WBPaper00064214 | ||||||
Curator_confirmed | WBPerson5063 | ||||||||
Reference | WBPaper00025979 | ||||||||
WBPaper00025190 | |||||||||
WBPaper00025033 | |||||||||
WBPaper00061173 | |||||||||
WBPaper00064214 | |||||||||
Remark | |||||||||
Method | Substitution_allele |