WormBase Tree Display for Variation: WBVar00054002
expand all nodes | collapse all nodes | view schema
| WBVar00054002 | Evidence | Paper_evidence | WBPaper00032087 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | ce312 | |||||
| Other_name | C14F11.3.1:c.1122+1G>A | ||||||
| HGVSg | CHROMOSOME_X:g.6226574C>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | C14F11 | |||
| Flanking_sequences | ttccatgaggaaagagatttgaccgttttg | tagtaatgattggagtgtaatttaaaaact | |||||
| Mapping_target | C14F11 | ||||||
| Type_of_mutation | Substitution | g | a | ||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | KG | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00001803 | |||||
| Transcript | C14F11.3.1 | VEP_consequence | splice_donor_variant | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | C14F11.3.1:c.1122+1G>A | ||||||
| Intron_number | 10/12 | ||||||
| Genetics | Interpolated_map_position | X | -3.37823 | ||||
| Description | Phenotype | WBPhenotype:0001897 | Paper_evidence | WBPaper00032087 | |||
| Curator_confirmed | WBPerson2021 | ||||||
| Remark | lite-1 mutants illuminated with optimal blue-violet light often showed no response to the light | Paper_evidence | WBPaper00032087 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| Variation_effect | Null | Paper_evidence | WBPaper00032087 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| Reference | WBPaper00032087 | ||||||
| Method | Substitution_allele |
