WormBase Tree Display for Variation: WBVar00054082
expand all nodes | collapse all nodes | view schema
WBVar00054082 | Evidence | Paper_evidence | WBPaper00031470 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ce363 | |||||||
Other_name | CE52173:p.Cys68Ser | ||||||||
F53F10.4b.1:c.664T>A | |||||||||
F53F10.4c.1:c.499T>A | |||||||||
CE52318:p.Cys222Ser | |||||||||
CE10986:p.Cys213Ser | |||||||||
CE52077:p.Cys167Ser | |||||||||
F53F10.4a.1:c.637T>A | |||||||||
F53F10.4d.1:c.202T>A | |||||||||
HGVSg | CHROMOSOME_I:g.3826035T>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F53F10 | |||||
Flanking_sequences | gcgacgggaggattgggcggtggatctgga | gctgttaatttttgatgatgtttctttgaa | |||||||
Mapping_target | F53F10 | ||||||||
Type_of_mutation | Substitution | t | a | Paper_evidence | WBPaper00031470 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | KG | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006833 | |||||||
Transcript | F53F10.4d.1 (12) | ||||||||
F53F10.4b.1 (12) | |||||||||
F53F10.4c.1 (12) | |||||||||
F53F10.4a.1 (12) | |||||||||
Genetics | Interpolated_map_position | I | -2.00715 | ||||||
Description | Phenotype | WBPhenotype:0000885 | Paper_evidence | WBPaper00031470 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants display the Ced phenotype | Paper_evidence | WBPaper00031470 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00031470 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031470 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00031470 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001325 | Paper_evidence | WBPaper00031470 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants are unable to sustain backing movement | Paper_evidence | WBPaper00031470 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00031470 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031470 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00031470 | ||||||||
Method | Substitution_allele |