WormBase Tree Display for Variation: WBVar00054157
expand all nodes | collapse all nodes | view schema
WBVar00054157 | Evidence | Paper_evidence | WBPaper00027321 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | cg121 | |||||||
Other_name | T21B6.1.2:c.220-162_*502del | ||||||||
T21B6.1.1:c.220-162_*502del | |||||||||
HGVSg | CHROMOSOME_X:g.10920730_10923124del | ||||||||
Sequence_details | SMap | S_parent | Sequence | T21B6 | |||||
Flanking_sequences | agagagcatacaagaaataagaaaatcacc | gtttcagaaatttctttgatgactcacgtg | |||||||
Mapping_target | T21B6 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00005032 | ||||||||
WBStrain00005038 | |||||||||
WBStrain00005039 | |||||||||
Laboratory | CH | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000961 | |||||||
Transcript | T21B6.1.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | T21B6.1.1:c.220-162_*502del | ||||||||
cDNA_position | ?-2370 | ||||||||
Intron_number | 3-6/7 | ||||||||
Exon_number | 4-8/8 | ||||||||
T21B6.1.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T21B6.1.2:c.220-162_*502del | ||||||||
cDNA_position | ?-2267 | ||||||||
Intron_number | 2-5/6 | ||||||||
Exon_number | 3-7/7 | ||||||||
Genetics | Interpolated_map_position | X | 2.70094 | ||||||
Description | Phenotype | WBPhenotype:0000688 | Paper_evidence | WBPaper00032026 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutation of the dgn-1 gene leads to sterility | Paper_evidence | WBPaper00032026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00032026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00032026 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000977 | Paper_evidence | WBPaper00032026 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Gonads of dgn-1 mutant worms were variably misshapen and burst during development. dgn-1(cg121) hermaphrodite gonads did not have any localized breaks as did the ten-1(ok641) gonads. | Paper_evidence | WBPaper00032026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00032026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005785 | PATO:0000460 | Paper_evidence | WBPaper00032026 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000709 | Paper_evidence | WBPaper00032026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The pharynx of the dgn-1 mutant worms shows no obvious defects | Paper_evidence | WBPaper00032026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00032026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003681 | PATO:0000460 | Paper_evidence | WBPaper00032026 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000023 | PATO:0000460 | Paper_evidence | WBPaper00032026 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | urEx131[LAM-1::GFP] | Paper_evidence | WBPaper00032026 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00032026 | ||||||||
Method | Deletion_allele |