WormBase Tree Display for Variation: WBVar00054167
expand all nodes | collapse all nodes | view schema
WBVar00054167 | Evidence | Paper_evidence | WBPaper00042307 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ch3 | |||||||
Other_name | F46C8.5.1:c.197+1_352del | ||||||||
HGVSg | CHROMOSOME_X:g.7530116_7531392del | ||||||||
Sequence_details | SMap | S_parent | Sequence | F46C8 | |||||
Flanking_sequences | agatcggttcgtttcaaaggtcaacggaag | atgttgttcgaaaagcatcgaatcatgtct | |||||||
Mapping_target | F46C8 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00034657 | ||||||||
Laboratory | TB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000438 | |||||||
Transcript | F46C8.5.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F46C8.5.1:c.197+1_352del | ||||||||
cDNA_position | ?-352 | ||||||||
CDS_position | ?-352 | ||||||||
Protein_position | ?-118 | ||||||||
Intron_number | 2-3/10 | ||||||||
Exon_number | 3-4/11 | ||||||||
Interactor (25) | |||||||||
Genetics (2) | |||||||||
Description | Phenotype | WBPhenotype:0000572 | Paper_evidence | WBPaper00042307 | |||||
Curator_confirmed | WBPerson1133 | ||||||||
WBPhenotype:0001224 | Paper_evidence | WBPaper00036308 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "To analyze axon migration, we therefore chose only animals in which unc-53:GFP intensity in the ALA cell body was comparable with wild type. Unexpectedly, ALA axons could not be identified in the vast majority of these ceh-14(ch3) unc-53:GFP+ animals (Fig 6D), indicating that CEH-14 functions at an early stage of axon projection... In the few ceh-14(ch3) animals in which we did observe lateral ALA axons, they extended well past the midbody, and the majority completed their migration to the tail (Fig 6B,D)... As CEH-14 is required for wild-type levels of CEH-17 in ALA, we would expect to see a ceh-17-like axon migration defect among the rare axons that do extend in the ceh-14 mutant; and indeed, some of the ALA axons in ceh-14(ch3) stop short of the tail (Fig 6D)." | Paper_evidence | WBPaper00036308 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003955 | PATO:0000460 | Paper_evidence | WBPaper00036308 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | unc-53:GFP | Paper_evidence | WBPaper00036308 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00036308 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We found that the ceh-14(ch3) mutation nearly abolished the expression of let-23/EGFR and severely affected the expression of plc-3/PLC-γ specifically within ALA (Table 2, Fig 1A,B)." | Paper_evidence | WBPaper00036308 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
The ceh-14(ch3) null mutant exhibits decreased expression of the ver-3::GFP transgene in the ALA neuron (Table 2) | Paper_evidence | WBPaper00036308 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
The ceh-14(ch3) null mutant exhibits decreased expression of the ida-1::GFP transgene in the ALA neuron (Table 2, Figure 3) | Paper_evidence | WBPaper00036308 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
The ceh-14(ch3) null mutant exhibits decreased expression of the flp-7::GFP transgene in the ALA neuron (Table 2, Figure 3) | Paper_evidence | WBPaper00036308 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
"We then investigated whether CEH-14 regulates the expression of a ceh-17:GFP reporter (pNP69; kindly provided by N. Pujol) which is normally expressed in ALA and the four SIA neurons (Pujol et_al, 2000). We found that ALA-specific expression of ceh-17:GFP was nearly abolished in the ceh-14 mutant throughout development (Fig 2B)." | Paper_evidence | WBPaper00036308 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
"We found that in ceh-14(ch3) animals, ceh-14:GFP expression in ALA is compromised at all stages examined, with a fraction of animals showing no detectable expression in ALA (Fig 2C), and the remaining animals having an ALA fluorescence intensity significantly lower than wild type (not shown). This autoregulatory effect is of a magnitude that makes it unlikely to be an indirect consequence of CEH-14-CEH-17 cross-regulatory interactions, as a complete loss of CEH-17 produces relatively mild defects in ceh-14 expression." | Paper_evidence | WBPaper00036308 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
"We analyzed the expression of des-2:GFP in the ALA neuron of ceh-14 and ceh-17 null mutant animals and found that at the L1 stage, reporter expression is dependent on CEH-14 but not on CEH-17 (Fig 4B), consistent with our observed genetic results with deg-3(gf). At the L4 stage, however, deg-3 expression is dependent on both factors (Fig 4B,C), revealing different temporal requirements for CEH-17 and CEH-14 in deg-3 expression." | Paper_evidence | WBPaper00036308 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
"We then examined unc-53:GFP expression in ceh-14 null mutant animals, and observed a mild but significant decrease in reporter expression, indicating that CEH-14 affects unc-53 transcription in ALA (Fig 6A)." | Paper_evidence | WBPaper00036308 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003955 | PATO:0000460 | Paper_evidence | WBPaper00036308 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | let-23:LET-23-GFP | Paper_evidence | WBPaper00036308 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
plc-3::YFP | Paper_evidence | WBPaper00036308 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
ver-3::GFP | Paper_evidence | WBPaper00036308 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
ida-1::GFP | Paper_evidence | WBPaper00036308 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
flp-7::GFP | Paper_evidence | WBPaper00036308 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
ceh-17::GFP | Paper_evidence | WBPaper00036308 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
ceh-14::GFP | Paper_evidence | WBPaper00036308 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
des-2:GFP | Paper_evidence | WBPaper00036308 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
unc-53:GFP | Paper_evidence | WBPaper00036308 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001524 | Paper_evidence | WBPaper00036308 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | 100% of ceh-14(ch3) animals were resistant to EGF-induced sleep (Table 1); "We found that similar to ceh-17 animals, the ALA neuron is present and its cell body is positioned normally (Fig 1A, DIC images) but the ceh-14(ch3) null mutant animals are completely resistant to the behavioral effects of EGF expression (Table 1)." | Paper_evidence | WBPaper00036308 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Complete | 100 | Paper_evidence | WBPaper00036308 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay (2) | |||||||||
WBPhenotype:0002211 | Paper_evidence | WBPaper00042307 | |||||||
Curator_confirmed | WBPerson1133 | ||||||||
WBPhenotype:0002433 | Paper_evidence | WBPaper00050011 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Resistance to pumping quiescence after heatshock in flp-13 mutants was much weaker than the negative controls, ceh-14 and ceh-17, suggesting that flp-13 is not the only neuropeptide necessary for pumping quiescence during stress-induced sleep (flp-13: 79% 3% pumping quiescent compared to ceh-14: 0% 0% and compared to ceh-17: 5% 3%; p < 0.001; Figure 2A). The ceh-14 and ceh-17 mutants, previously shown to bestrongly resistant to heat shock [7, 14], displayed locomotionquiescence after heat shock (ceh-14: 0% 0% locomotionquiescent before heat shock compared to ceh-14: 36% 4%locomotion quiescent after heat shock; ceh-17: 0% 0% locomotionquiescent before heat shock compared to ceh-17:56% 5% locomotion quiescent after heat shock; p < 0.01;Figure 2B). | Paper_evidence | WBPaper00050011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002512 | Paper_evidence | WBPaper00042307 | |||||||
Curator_confirmed | WBPerson1133 | ||||||||
Phenotype_not_observed | WBPhenotype:0000306 | Paper_evidence | WBPaper00036308 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | The ceh-14(ch3) null mutant exhibits no change in expression of the unc-119::YFP transgene in the ALA neuron (Table 2) | Paper_evidence | WBPaper00036308 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
The ceh-14(ch3) null mutant exhibits no change in expression of the rab-3::GFP transgene in the ALA neuron (Table 2) | Paper_evidence | WBPaper00036308 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003955 | PATO:0000460 | Paper_evidence | WBPaper00036308 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | unc-119::YFP | Paper_evidence | WBPaper00036308 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
rab-3::GFP | Paper_evidence | WBPaper00036308 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001310 | Paper_evidence | WBPaper00036308 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We found that similar to ceh-17 animals, the ALA neuron is present and its cell body is positioned normally (Fig 1A, DIC images) but the ceh-14(ch3) null mutant animals are completely resistant to the behavioral effects of EGF expression (Table 1)." | Paper_evidence | WBPaper00036308 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003955 | PATO:0000460 | Paper_evidence | WBPaper00036308 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00042307 | ||||||||
WBPaper00036308 | |||||||||
WBPaper00011591 | |||||||||
WBPaper00050011 | |||||||||
WBPaper00066004 | |||||||||
Method | Deletion_allele |