WormBase Tree Display for Variation: WBVar00054292
expand all nodes | collapse all nodes | view schema
WBVar00054292 | Evidence | Paper_evidence | WBPaper00005344 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | cs28 | |||||||
Other_name | R11E3.6a.1:c.779_795-5del | ||||||||
HGVSg | CHROMOSOME_IV:g.4798113_4798179del | ||||||||
Sequence_details | SMap | S_parent | Sequence | R11E3 | |||||
Flanking_sequences | tgctatcgaaaagtcagaaaagtcgatttt | gtagggaaacaaataacatgcttatggaaa | |||||||
Mapping_target | R11E3 | ||||||||
Type_of_mutation | Deletion | tgctactacatgtcatgtaagtggagttgttaaagtttacaaaattatta ctgatgaaataattttt | Person_evidence | WBPerson637 | |||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00035410 | ||||||||
Laboratory | UP | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001324 | |||||||
Transcript | R11E3.6a.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | R11E3.6a.1:c.779_795-5del | ||||||||
cDNA_position | 781-? | ||||||||
CDS_position | 779-? | ||||||||
Protein_position | 260-? | ||||||||
Intron_number | 6/16 | ||||||||
Exon_number | 6/17 | ||||||||
Interactor (55) | |||||||||
Genetics | Interpolated_map_position | IV | 1.25862 | ||||||
Description | Phenotype | WBPhenotype:0000112 | Paper_evidence | WBPaper00035551 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | In Western analyses, a polyclonal antibody against EOR-1 equally recognizes a band at the predicted size of EOR-1 (115 kDa) in wild-type animals but not in eor-1(cs28) animals. | Paper_evidence | WBPaper00035551 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00035551 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000134 | Paper_evidence | WBPaper00054564 | |||||||
Curator_confirmed | WBPerson3890 | ||||||||
Remark | Figure 1, reduced expression of Pabts-1b::gfp, Pkcc-2c::gfp, and Pida-1::gfp in HSNs. | Paper_evidence | WBPaper00054564 | ||||||
Curator_confirmed | WBPerson3890 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00054564 | ||||
Curator_confirmed | WBPerson3890 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00005344 | |||||||
WBPaper00057072 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPerson712 | |||||||||
Remark | 5% (n = 41) of eor-1(cs28) mutants lacked normal EGL-17::GFP expression in P6.p or its daughters. | Paper_evidence | WBPaper00005344 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
"eor-1(cs28), a null allele, failed to complement ju198 for the RMED/V phenotypes" | Paper_evidence | WBPaper00057072 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Image | WBPicture0000014911 | Paper_evidence | WBPaper00057072 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00005344 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00005344 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Hypomorph_reduction_of_function | Paper_evidence | WBPaper00057072 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0008125 | PATO:0000460 | Paper_evidence | WBPaper00005344 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0005027 | PATO:0000460 | Paper_evidence | WBPaper00057072 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005021 | PATO:0000460 | Paper_evidence | WBPaper00057072 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | EGL-17::GFP | Paper_evidence | WBPaper00005344 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000306 | Paper_evidence | WBPaper00038408 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | lag-2p(min) and lag-2p(min deletion VPCrep) transcription was not affected by loss of eor-1. | Paper_evidence | WBPaper00038408 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001236 | Paper_evidence | WBPaper00054844 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | eor-1 mutants did not show enhancement of Pabts-1b::gfp expression by pkc-1(gf) (Figure 1C) | Paper_evidence | WBPaper00054844 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Image | WBPicture0000013878 | Paper_evidence | WBPaper00054844 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | vsIs138[Pabts-1b::gfp, lin15(+)]; Ex[Pmec-7::pkc-1(gf) SL2 mCherry, Pmyo-2::gfp] | Paper_evidence | WBPaper00054844 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00038408 | ||||||||
WBPaper00005344 | |||||||||
WBPaper00010208 | |||||||||
WBPaper00035551 | |||||||||
WBPaper00054564 | |||||||||
WBPaper00057072 | |||||||||
WBPaper00054844 | |||||||||
Remark | cs28 is a 67bp deletion. Breakpoints were sent by personal communication and are different to those described in PMID 12130541 | Curator_confirmed | WBPerson2970 | ||||||
Method | Deletion_allele |