WormBase Tree Display for Variation: WBVar00066294
expand all nodes | collapse all nodes | view schema
WBVar00066294 | Name | Public_name | cxTi4018 | ||||
---|---|---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | F32H2 | |||
Flanking_sequences | gaactgcaatggacttcaaggatttgtaat | atttcattcatttggaggaggaactggatc | |||||
Mapping_target | F32H2 | ||||||
Type_of_mutation | Insertion | ||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Transposon_insertion | Tc3 | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00024648 | ||||||
Laboratory | IE | ||||||
NemaGENETAG_consortium_allele | |||||||
Status | Live | ||||||
Affects (3) | |||||||
Description | Phenotype | WBPhenotype:0000615 | Paper_evidence | WBPaper00036195 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | 78% (n=36) of tba-6 mutant cilia were defective, exhibiting an inward-bending, hook-like appearance. | Paper_evidence | WBPaper00036195 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00036195 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Ciliary enrichment of TBB-4::YFP was observed in 67% (n=108) of rays in wild-type males but in only 36%(n=69) of tba-6 mutant male rays. | Animals exhibited a gross mislocalization of KLP-6::GFP in cilia. | In wild-type controls, 56% of rays (n=88) had detectable PKD-2::GFP in the RnB cilium tips. This Enrichment to the distal region of the dendrite was still present in most tba-6 mutant rays (82%). | Paper_evidence | WBPaper00036195 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001221 | Paper_evidence | WBPaper00036195 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | A significant reduction was observed in the response of mutants to nose touch when compared to wild-type controls. | Paper_evidence | WBPaper00036195 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0004006 | Paper_evidence | WBPaper00036195 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Mutant males responded with a frequency of 73% (n=96). | Paper_evidence | WBPaper00036195 | ||||
Curator_confirmed | WBPerson712 | ||||||
Phenotype_not_observed | WBPhenotype:0000649 | Paper_evidence | WBPaper00036195 | ||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Males that responded to contact were able to locate the hermaphrodite vulva with wild-type efficiency and mate successfully. | Paper_evidence | WBPaper00036195 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0004017 | Paper_evidence | WBPaper00036195 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | No consistent abnormalities were observed in wavelength, amplitude, frequency, or bend angle (flex) in mutants. | Paper_evidence | WBPaper00036195 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00036195 | ||||||
Remark (3) | |||||||
Method | NemaGENETAG_consortium_allele |