WormBase Tree Display for Variation: WBVar00066294

WBVar00066294 Name: Public_name: cxTi4018
  Sequence_details: SMap: S_parent: Sequence: F32H2
    Flanking_sequences: gaactgcaatggacttcaaggatttgtaat atttcattcatttggaggaggaactggatc
    Mapping_target: F32H2
    Type_of_mutation: Insertion
    SeqStatus: Sequenced
  Variation_type: Allele
    Transposon_insertion: Tc3
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00024648
    Laboratory: IE
    NemaGENETAG_consortium_allele
    Status: Live
  Affects: Gene: WBGene00006532
    Transcript: F32H2.9.1
    Interactor: WBInteraction000504817
  Description: Phenotype (4)
    Phenotype_not_observed: WBPhenotype:0000649 Paper_evidence: WBPaper00036195
        Curator_confirmed: WBPerson712
        Remark: Males that responded to contact were able to locate the hermaphrodite vulva with wild-type efficiency and mate successfully. Paper_evidence: WBPaper00036195
            Curator_confirmed: WBPerson712
      WBPhenotype:0004017 Paper_evidence: WBPaper00036195
        Curator_confirmed: WBPerson712
        Remark: No consistent abnormalities were observed in wavelength, amplitude, frequency, or bend angle (flex) in mutants. Paper_evidence: WBPaper00036195
            Curator_confirmed: WBPerson712
  Reference: WBPaper00036195
  Remark: [20051214 db] renamed from cxP4018
    [20060511 db] removed by request of Segalat lab; Tc insertion could not be recovered
    Resurrected
  Method: NemaGENETAG_consortium_allele