WormBase Tree Display for Variation: WBVar00087946

WBVar00087946 Evidence: Paper_evidence: WBPaper00031192
  Name: Public_name: hx546
    Other_name: CE43431:p.Pro842Ser
      B0334.8a.1:c.2524C>T
    HGVSg: CHROMOSOME_II:g.11523674G>A
  Sequence_details: SMap: S_parent: Sequence: Y62F5A
    Flanking_sequences: attagtcataaaatggaaaatatggattct cactggatcctgtgtacaaactgggtgaaa
    Mapping_target: Y62F5A
    Type_of_mutation: Substitution: c t Paper_evidence: WBPaper00031192
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00008402
      WBStrain00026651
      WBStrain00030709
      WBStrain00034896
      WBStrain00034898
      WBStrain00034902
      WBStrain00048295
      WBStrain00056868
      WBStrain00056869
      WBStrain00056870
    Laboratory: MK
      TJ
      GOU
    Status: Live
  Affects: Gene: WBGene00000090
    Transcript: B0334.8a.1 VEP_consequence: missense_variant
        VEP_impact: MODERATE
        HGVSc: B0334.8a.1:c.2524C>T
        HGVSp: CE43431:p.Pro842Ser
        cDNA_position: 2524
        CDS_position: 2524
        Protein_position: 842
        Exon_number: 5/10
        Codon_change: Cca/Tca
        Amino_acid_change: P/S
    Interactor (31)
  Genetics: Interpolated_map_position: II 3.61257
    Mapping_data: In_multi_point: 1070
        1071
        1072
  Description: Phenotype (21)
    Phenotype_not_observed: WBPhenotype:0000136 Paper_evidence: WBPaper00004599
        Curator_confirmed: WBPerson2987
        Remark: age-1(hx546) mutants did not show significantly greater mRNA expression of the mtl-1 gene (Figure 4) compared to wild type under basal or cadmium-exposed conditions, as indicated by competitive quantitative RT-PCR Paper_evidence: WBPaper00004599
            Curator_confirmed: WBPerson2987
      WBPhenotype:0000147 Paper_evidence: WBPaper00040181
        Curator_confirmed: WBPerson712
        Remark: The starvation induced ribosome biogenesis was not ablated in the starved male worms. Starvation-enhanced rRNA biosynthesisoccurs in adult males. Paper_evidence: WBPaper00040181
            Curator_confirmed: WBPerson712
        EQ_annotations: Life_stage: WBls:0000056 PATO:0000460 Paper_evidence: WBPaper00040181
                Curator_confirmed: WBPerson712
      WBPhenotype:0001180 Paper_evidence: WBPaper00048406
        Curator_confirmed: WBPerson2987
        Remark: "... AGE-1 and DAF-18, which produce and hydrolyze PtdIns(3,4,5) P3, respectively, or R01H10.7, an INPP4A homologue that dephosphorylates PtdIns(3,4)P2, are all dispensable for apoptotic cell clearance (Fig S1, R-X)." Paper_evidence: WBPaper00048406
            Curator_confirmed: WBPerson2987
      WBPhenotype:0001470 Paper_evidence: WBPaper00037970
        Curator_confirmed: WBPerson2987
        Remark: Mutants exhibited no change in chemotaxis towards diacetyl, compared to wild type controls (Figure 2A) Paper_evidence: WBPaper00037970
            Curator_confirmed: WBPerson2987
        Affected_by: Molecule: WBMol:00002819 Paper_evidence: WBPaper00037970
              Curator_confirmed: WBPerson2987
      WBPhenotype:0001871 Paper_evidence: WBPaper00035656
        Curator_confirmed: WBPerson2021
        Remark: Like wildtype, metformin treatment extends median lifespan in age-1 mutants Paper_evidence: WBPaper00035656
            Curator_confirmed: WBPerson2021
      WBPhenotype:0004023 Paper_evidence: WBPaper00037970
        Curator_confirmed: WBPerson2987
        Remark: Mutant animals exhibit a wild type frequency of body bends (Figure 3A) Paper_evidence: WBPaper00037970
            Curator_confirmed: WBPerson2987
  Reference (61)
  Method: Substitution_allele