WormBase Tree Display for Variation: WBVar00087953
expand all nodes | collapse all nodes | view schema
WBVar00087953 | Evidence | Paper_evidence | WBPaper00004762 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ia4 | ||||||
Other_name | ia04 | Paper_evidence | WBPaper00031883 | |||||
F38A6.3a.1:c.21-128_682-247del | ||||||||
F38A6.3d.1:c.21-128_682-247del | ||||||||
F38A6.3b.1:c.21-128_682-247del | ||||||||
HGVSg | CHROMOSOME_V:g.20781187_20782417del | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_V | ||||
Flanking_sequences | ctcctcctactccacctttgaaaaaataaa | agagaagtagagaagcacaagcacatgcaa | ||||||
Mapping_target | CHROMOSOME_V | |||||||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (19) | ||||||||
Laboratory | ZG | |||||||
History | Acquires_merge | WBVar00087952 | ||||||
Status | Live | |||||||
Affects | Gene | WBGene00001851 | ||||||
Transcript | F38A6.3e.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
Intron_number | 1-3/7 | |||||||
Exon_number | 1-3/8 | |||||||
F38A6.3b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F38A6.3b.1:c.21-128_682-247del | |||||||
Intron_number | 2-5/10 | |||||||
Exon_number | 3-5/11 | |||||||
F38A6.3d.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F38A6.3d.1:c.21-128_682-247del | |||||||
Intron_number | 2-5/11 | |||||||
Exon_number | 3-5/12 | |||||||
F38A6.3a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F38A6.3a.1:c.21-128_682-247del | |||||||
Intron_number | 2-5/10 | |||||||
Exon_number | 3-5/11 | |||||||
F38A6.3f.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 1-3/7 | |||||||
Exon_number | 1-3/8 | |||||||
Interactor (23) | ||||||||
Isolation | Mutagen | EMS | ||||||
Genetics | Interpolated_map_position | V | 25.1943 | |||||
Mapping_data | In_multi_point | 4401 | ||||||
Description | Phenotype (30) | |||||||
Phenotype_not_observed | WBPhenotype:0000112 | Paper_evidence | WBPaper00048983 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "We similarly found little change in global translation when hif-1(ia04) mutant animals, which are also sensitive to H2S, were exposed to 50 ppm H2S (Fig. 2C)." | Paper_evidence | WBPaper00048983 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00004296 | Paper_evidence | WBPaper00048983 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000497 | Paper_evidence | WBPaper00036343 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | No significant change in embryonic lethality in hif-1(ia4) mutants compared to wild-type worms after IR | Paper_evidence | WBPaper00036343 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000520 | Paper_evidence | WBPaper00042557 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Loss-of-function of hif-1 did not lead to any detectable phenotype. | Paper_evidence | WBPaper00042557 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000712 | Paper_evidence | WBPaper00036343 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | No significant change in germ cell death in hif-1(ia4) mutants compared to wild-type worms after IR | Paper_evidence | WBPaper00036343 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00043917 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "We therefore tested paraquat-induced expression of hsp-6::gfp in loss-of-function mutants of skn-1(zu67), daf-16(mu86) and hif-1(ia4). We found that none of the mutants prevented the induction of hsp-6 upon 0.5 mM paraquat exposure (Figure 5). This suggests that the response to paraquat triggers a pathway that does not require the transcription factors SKN-1, DAF-16 and HIF-1, and probably also not the pathways in which these factors are effectors namely the cytosolic stress response, insulin signaling, and the heat shock response." | Paper_evidence | WBPaper00043917 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00002747 | Paper_evidence | WBPaper00043917 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001326 | Paper_evidence | WBPaper00036343 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | No significant change in germ cell death in hif-1(ia4) mutants compared to wild-type worms after IR | Paper_evidence | WBPaper00036343 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001380 | Paper_evidence | WBPaper00037959 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | hif-1(ia04) mutant animals did not show a lower survival rate in the Anaerolcult A mini culture than wild-type ones. | Paper_evidence | WBPaper00037959 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00005312 | Paper_evidence | WBPaper00037959 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001381 | Paper_evidence | WBPaper00046527 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | hif-1(ia4) mutant worms were not resistant to anoxia exposure when fed a glucose-supplemented diet (Figure S1C) | Paper_evidence | WBPaper00046527 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00003916 | Paper_evidence | WBPaper00046527 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031935 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals showed carbon dioxide avoidance similar to wild-type animals. | Paper_evidence | WBPaper00031935 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Strains were maintained at 22C. Animals were exposed to a 5% to 0% CO2 gradient. | Paper_evidence | WBPaper00031935 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002060 | Paper_evidence | WBPaper00035580 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "When fed Cry21A , hif-1 ( ia04 ) animals have a response that is indistinguishable from wild-type animals ( Figure 2B ; Table 1 ) ." | Paper_evidence | WBPaper00035580 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Disease_info | Models_disease | DOID:162 | ||||||
Models_disease_in_annotation | WBDOannot00000595 | |||||||
Reference (26) | ||||||||
Remark | ia4 is a 1,231 bp deletion of exons 2,3 and 4 of hif-1. This introduces a frameshift and premature stop in the mutant mRNA. Deletion endpoints are not specified in the paper and so have been estimated from Figure 1. | Paper_evidence | WBPaper00004762 | |||||
Curator_confirmed | WBPerson1971 | |||||||
Method | Deletion_allele |