WormBase Tree Display for Variation: WBVar00087967
expand all nodes | collapse all nodes | view schema
WBVar00087967 | Evidence | Paper_evidence | WBPaper00005131 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ij48 | |||||||
Other_name | ij048 | ||||||||
CE11778:p.Ser46Phe | |||||||||
K06A5.7.1:c.137C>T | |||||||||
HGVSg | CHROMOSOME_I:g.6471766G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | K06A5 | |||||
Flanking_sequences | tatttgaagaagatggcagctcccgcgatt | tggtttgtcatgtaaatggaaggcttaatt | |||||||
Mapping_target | K06A5 | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00008606 | ||||||||
Laboratory | IA | ||||||||
Status | Live | ||||||||
Linked_to | WBVar00087966 | ||||||||
Affects | Gene | WBGene00000386 | |||||||
Transcript | K06A5.7.1 | VEP_consequence | missense_variant,splice_region_variant | ||||||
VEP_impact | MODERATE | ||||||||
HGVSc | K06A5.7.1:c.137C>T | ||||||||
HGVSp | CE11778:p.Ser46Phe | ||||||||
cDNA_position | 157 | ||||||||
CDS_position | 137 | ||||||||
Protein_position | 46 | ||||||||
Exon_number | 2/9 | ||||||||
Codon_change | tCt/tTt | ||||||||
Amino_acid_change | S/F | ||||||||
Interactor | WBInteraction000557537 | ||||||||
WBInteraction000557538 | |||||||||
Genetics | Interpolated_map_position | I | 1.14042 | ||||||
Mapping_data | In_pos_neg_data | 10670 | |||||||
10671 | |||||||||
10680 | |||||||||
Description | Phenotype | WBPhenotype:0000171 | Paper_evidence | WBPaper00005131 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Many extra divisions were observed of cells derived from the E blastomere. Time between cell divisions was shortened. | Paper_evidence | WBPaper00005131 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | High | Almost 100%. | Paper_evidence | WBPaper00005131 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Dominant | Paper_evidence | WBPaper00005131 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00005131 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004804 | PATO:0000460 | Paper_evidence | WBPaper00005131 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00005131 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | ijIs10 | Paper_evidence | WBPaper00005131 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000503 | Paper_evidence | WBPaper00005131 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Intestinal cells are indictated to undergo rounds of endoreduplication based on an increase in size during larval development. | Paper_evidence | WBPaper00005131 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | High | Almost 100%. | Paper_evidence | WBPaper00005131 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Dominant | Paper_evidence | WBPaper00005131 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00005131 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00005131 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | ijIs10 | Paper_evidence | WBPaper00005131 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000504 | Paper_evidence | WBPaper00005131 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No intestinal nuclear divisions were observed during L1 development, but many were observed during L2 larval stage. Postembryonic divisions were not synchronous as opposed to the process in wild type. | Paper_evidence | WBPaper00005131 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | High | Almost 100%. | Paper_evidence | WBPaper00005131 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Dominant | Paper_evidence | WBPaper00005131 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00005131 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00005131 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000027 | PATO:0000460 | Paper_evidence | WBPaper00005131 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00005131 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | ijIs10 | Paper_evidence | WBPaper00005131 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000708 | Paper_evidence | WBPaper00005131 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The organization of the excess intestinal cells appears chaotic. | Paper_evidence | WBPaper00005131 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | High | Almost 100%. | Paper_evidence | WBPaper00005131 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Dominant | Paper_evidence | WBPaper00005131 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00005131 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000018 | PATO:0000460 | Paper_evidence | WBPaper00005131 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00005131 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | ijIs10 | Paper_evidence | WBPaper00005131 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000834 | Paper_evidence | WBPaper00005131 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Cell cycle control in the E lineage cells is shortened but terminal differentiation of cells is not significantly alterered. | Paper_evidence | WBPaper00005131 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | High | Almost 100%. | Paper_evidence | WBPaper00005131 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Dominant | Paper_evidence | WBPaper00005131 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00005131 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004804 | PATO:0000460 | Paper_evidence | WBPaper00005131 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00005131 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | ijIs10 | Paper_evidence | WBPaper00005131 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001636 | Paper_evidence | WBPaper00005131 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Extra intestinal nuclei are born during embryogenesis (intestinal hyperplasia) as demonstrated by the expression of elt-2::GFP in 50-100% more animals than wild type and of cpr-5::GFP positive nuclei compared to wild type. In addition, there are many more intestinal cell boundaries in these animals compared with wild type as demonstrated by MH27 antibody immunofluoresence. | Paper_evidence | WBPaper00005131 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Dominant | Paper_evidence | WBPaper00005131 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00005131 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00005131 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00005131 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | ijIs10 and or wIs84 | Paper_evidence | WBPaper00005131 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001851 | Paper_evidence | WBPaper00027700 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | These mutants are significantly radiosensitive compared with N2 C. elegans. Radiation induced vulval cell loss causes vulval abnormalities (Pvl/ Vul) | Paper_evidence | WBPaper00027700 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00027700 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00027700 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00027700 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 100-400 Gy radiation | Paper_evidence | WBPaper00027700 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed (11) | |||||||||
Reference | WBPaper00027700 | ||||||||
WBPaper00005131 | |||||||||
WBPaper00019707 | |||||||||
WBPaper00027541 | |||||||||
Method | Substitution_allele |