WormBase Tree Display for Variation: WBVar00088002

WBVar00088002 Evidence: Paper_evidence: WBPaper00003779
  Name: Public_name: it21
    Other_name: CE24714:p.Gln738Ter
      ZK1127.1.1:c.*203G>A
      ZK1127.11.1:c.2212C>T
    HGVSg: CHROMOSOME_II:g.7066848G>A
  Sequence_details: SMap: S_parent: Sequence: ZK1127
    Flanking_sequences: tcgacgaaaaagcacaagttgttacgtgga aatatagaggaccattatacggtattaata
    Mapping_target: ZK1127
    Type_of_mutation: Substitution: c t Paper_evidence: WBPaper00003779
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00000291
    Laboratory: KK
    Status: Live
  Affects: Gene: WBGene00003784
      WBGene00001872
    Transcript: ZK1127.1.1 VEP_consequence: 3_prime_UTR_variant
        VEP_impact: MODIFIER
        HGVSc: ZK1127.1.1:c.*203G>A
        cDNA_position: 1039
        Exon_number: 7/7
      ZK1127.11.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: ZK1127.11.1:c.2212C>T
        HGVSp: CE24714:p.Gln738Ter
        cDNA_position: 2212
        CDS_position: 2212
        Protein_position: 738
        Exon_number: 15/19
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
  Genetics: Interpolated_map_position: II 0.423223
  Description: Phenotype: WBPhenotype:0000050 Paper_evidence: WBPaper00003779
        Curator_confirmed: WBPerson712
        Remark: Produce nearly normal numbers of embryos, but 97% of these fail to hatch (n = 3777). Paper_evidence: WBPaper00003779
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00003779
            Curator_confirmed: WBPerson712
      WBPhenotype:0001175 Paper_evidence: WBPaper00003779
        Curator_confirmed: WBPerson712
        Remark: Among progeny that do survive to adulthood, 45% are male, indicative of a severe chromosome segregation defect. Paper_evidence: WBPaper00003779
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00003779
            Curator_confirmed: WBPerson712
      WBPhenotype:0001814 Paper_evidence: WBPaper00003779
        Curator_confirmed: WBPerson712
        Remark: Cytological examination of DAPI-stained chromosomes late in meiotic prophase reveals an absence of chiasmata in him-14 mutant oocytes that readily accounts for the observed chromosome segregation defect. In him-14 mutants 12, rather than the wild-type 6, discrete DAPI-stained bodies could be clearly resolved in the majority of oocyte nuclei, indicating an absence of chiasmata. Specifically, an average of 11.6 DAPI-staining bodies were resolved in 147 nuclei from 21 hermaphrodites, indicating that most, if not all, chromosomes lack chiasmata. For an interval encompassing 80% of the X chromosome, the crossover frequency in him-14(it21) homozygous her- maphrodites was reduced to less than 1% of the wild-type level. Paper_evidence: WBPaper00003779
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00003779
            Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0001946 Paper_evidence: WBPaper00003779
        Curator_confirmed: WBPerson712
        Remark: oocyte chromosomes exhibit normal pachytene morphology Paper_evidence: WBPaper00003779
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00003779
            Curator_confirmed: WBPerson712
  Reference: WBPaper00003779
  Remark: In addition to the nonsense mutation described, the it21 mutant also contains a further 15 base substitutions and several small deletions and insertions over a 571-bp region. Paper_evidence: WBPaper00003779
  Method: Substitution_allele