WormBase Tree Display for Variation: WBVar00088027

WBVar00088027 Evidence: Paper_evidence: WBPaper00003944
  Name: Public_name: it57
    Other_name: CE46046:p.Pro248Ser
      CE27410:p.Pro389Ser
      CE46081:p.Pro385Ser
      Y59A8B.14c.1:c.1153C>T
      Y59A8B.14b.1:c.742C>T
      Y59A8B.14a.1:c.1165C>T
    HGVSg: CHROMOSOME_V:g.18104270C>T
  Sequence_details: SMap: S_parent: Sequence: Y37H2A
    Flanking_sequences: accctgtacaacctggtttctggaaaatat cattcgaaaagcctgttctattgaaattgt
    Mapping_target: Y37H2A
    Type_of_mutation: Substitution: c t Paper_evidence: WBPaper00003944
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00023557
    Laboratory: KK
    Status: Live
  Affects: Gene: WBGene00003919
    Transcript: Y59A8B.14a.1 VEP_consequence: missense_variant
        VEP_impact: MODERATE
        HGVSc: Y59A8B.14a.1:c.1165C>T
        HGVSp: CE27410:p.Pro389Ser
        cDNA_position: 1165
        CDS_position: 1165
        Protein_position: 389
        Exon_number: 8/11
        Codon_change: Cca/Tca
        Amino_acid_change: P/S
      Y59A8B.14b.1 VEP_consequence: missense_variant
        VEP_impact: MODERATE
        HGVSc: Y59A8B.14b.1:c.742C>T
        HGVSp: CE46046:p.Pro248Ser
        cDNA_position: 742
        CDS_position: 742
        Protein_position: 248
        Exon_number: 5/8
        Codon_change: Cca/Tca
        Amino_acid_change: P/S
      Y59A8B.14c.1 VEP_consequence: missense_variant
        VEP_impact: MODERATE
        HGVSc: Y59A8B.14c.1:c.1153C>T
        HGVSp: CE46081:p.Pro385Ser
        cDNA_position: 1153
        CDS_position: 1153
        Protein_position: 385
        Exon_number: 8/11
        Codon_change: Cca/Tca
        Amino_acid_change: P/S
    Interactor (34)
  Genetics: Interpolated_map_position: V 14.1066
    Mapping_data: In_pos_neg_data: 4294
        4295
        4296
  Description: Phenotype (15)
    Phenotype_not_observed: WBPhenotype:0000034 Paper_evidence: WBPaper00038098
        Curator_confirmed: WBPerson712
        Remark: No obvious modifications were observed in the organization of the myosin network: the number and the area of NMY-2::GFP foci in par-4 mutants were identical to wild-type embryos during the polarization phase. Paper_evidence: WBPaper00038098
            Curator_confirmed: WBPerson712
      WBPhenotype:0000039 Paper_evidence: WBPaper00041842
        Curator_confirmed: WBPerson2987
        Remark: Table 2, SIII Paper_evidence: WBPaper00041842
            Curator_confirmed: WBPerson2987
      WBPhenotype:0000462 Paper_evidence: WBPaper00031692
        Curator_confirmed: WBPerson2021
        Remark: par-4(it57) mutant at 25 C was not significantly hypersensitive to paraquat Paper_evidence: WBPaper00031692
            Curator_confirmed: WBPerson2021
        Affected_by: Molecule: WBMol:00002747 Paper_evidence: WBPaper00031692
              Curator_confirmed: WBPerson2021
        Temperature_sensitive: Heat_sensitive: 25C Paper_evidence: WBPaper00031692
              Curator_confirmed: WBPerson2021
      WBPhenotype:0000634 Paper_evidence: WBPaper00031692
        Curator_confirmed: WBPerson2021
        Remark: Pharyngeal pumping was unaffected in mutants Paper_evidence: WBPaper00031692
            Curator_confirmed: WBPerson2021
        Temperature_sensitive: Heat_sensitive: 25C Paper_evidence: WBPaper00031692
              Curator_confirmed: WBPerson2021
      WBPhenotype:0000640 Paper_evidence: WBPaper00031692
        Curator_confirmed: WBPerson2021
        Remark: Egg laying was unaffected in mutants Paper_evidence: WBPaper00031692
            Curator_confirmed: WBPerson2021
        Temperature_sensitive: Heat_sensitive: 25C Paper_evidence: WBPaper00031692
              Curator_confirmed: WBPerson2021
      WBPhenotype:0001540 Paper_evidence: WBPaper00032396
        Curator_confirmed: WBPerson2987
        Remark: par-4(it57);daf-2(e1370) double mutant animals did not exhibit a significantly reduced dauer life span compared to control daf-2(e1370) mutant animals (Table 1) Paper_evidence: WBPaper00032396
            Curator_confirmed: WBPerson2987
        Phenotype_assay: Treatment: C. elegans were synchronized and plated at 25 degrees Celsius. Three days later, ~10 dauer larvae were randomly picked into a 20 microliter drop of double-distilled water suspended under a Petri dish cover. A wet tissue was placed in the bottom of the dish to maintain humidity, and the plate was sealed with Parafilm. Dauer longevity was monitored daily, and survival was scored as moving response upon exposure to a focused beam of 425-440 nm light. Paper_evidence: WBPaper00032396
              Curator_confirmed: WBPerson2987
          Temperature: 25 Paper_evidence: WBPaper00032396
              Curator_confirmed: WBPerson2987
          Genotype: daf-2(e1370) Paper_evidence: WBPaper00032396
              Curator_confirmed: WBPerson2987
      WBPhenotype:0001702 Paper_evidence: WBPaper00031692
        Curator_confirmed: WBPerson2021
        Remark: Directional reversal of locomotion was unaffected in mutants Paper_evidence: WBPaper00031692
            Curator_confirmed: WBPerson2021
        Temperature_sensitive: Heat_sensitive: 25C Paper_evidence: WBPaper00031692
              Curator_confirmed: WBPerson2021
      WBPhenotype:0001885 Paper_evidence: WBPaper00038098
        Curator_confirmed: WBPerson712
        Remark: The initiation of ingression was similar between wild-type and par-4 mutant embryos during the first minute following ring formation. Paper_evidence: WBPaper00038098
            Curator_confirmed: WBPerson712
      WBPhenotype:0002005 Paper_evidence: WBPaper00038098
        Curator_confirmed: WBPerson712
        Remark: No difference was observed in the cortical tension of the actomyosin network from controls. Paper_evidence: WBPaper00038098
            Curator_confirmed: WBPerson712
  Disease_info: Models_disease: DOID:3852
    Models_disease_in_annotation: WBDOannot00000893
  Reference: WBPaper00038098
    WBPaper00041842
    WBPaper00013900
    WBPaper00014312
    WBPaper00035656
    WBPaper00013870
    WBPaper00003944
    WBPaper00031692
    WBPaper00032396
    WBPaper00055640
  Method: Substitution_allele