WormBase Tree Display for Variation: WBVar00088136
expand all nodes | collapse all nodes | view schema
WBVar00088136 | Name | Public_name | ju2 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | F35D2.5a.1:c.1471C>T | ||||||||
CE33391:p.Arg491Ter | |||||||||
F35D2.5c.2:c.673C>T | |||||||||
F35D2.5c.1:c.673C>T | |||||||||
CE33392:p.Arg225Ter | |||||||||
HGVSg | CHROMOSOME_II:g.7588281G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | R07G3 | |||||
Flanking_sequences | taaacttttttgttttcagagcaacaattt | gattgtctaatggaagtccgggaagaactg | |||||||
Mapping_target | R07G3 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00005543 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | CZ | ||||||||
Status | Live | ||||||||
Affects (3) | |||||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00005543 | |||||
Genetics | Interpolated_map_position | II | 0.504799 | ||||||
Mapping_data | In_multi_point | 4715 | |||||||
Description | Phenotype (5) | ||||||||
Phenotype_not_observed | WBPhenotype:0000944 | Paper_evidence | WBPaper00005543 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Loss of syd-1 function causes morphologically normal axonal specializations to form in the dendritic processes of VDs, based on ultrastructural analysis of VD dorsal process presynaptic specializations and placement of postsynaptic muscle arm membranes. | Paper_evidence | WBPaper00005543 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002262 | Paper_evidence | WBPaper00005543 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | postsynaptic localization of an AMPA-type glutamate receptor marker, GLR-1::GFP was unaltered. | Paper_evidence | WBPaper00005543 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005303 | PATO:0000460 | Paper_evidence | WBPaper00005543 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005270 | PATO:0000460 | Paper_evidence | WBPaper00005543 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00005543 | ||||||||
Remark | Flanking sequences refer to F35D2.5c isoform | Curator_confirmed | WBPerson1845 | ||||||
Method | Substitution_allele |