WormBase Tree Display for Variation: WBVar00088187
expand all nodes | collapse all nodes | view schema
WBVar00088187 | Name | Public_name | k12 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | CE42802:p.Cys268Tyr | |||||||
F37D6.1.1:c.803G>A | ||||||||
HGVSg | CHROMOSOME_I:g.10483895C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | F37D6 | ||||
Flanking_sequences | AGTGCCTGGAACCATGTCAAAAACCAGAT | TAGCTATCTTATCAGTGATAAAATTACTGG | ||||||
Mapping_target | F37D6 | |||||||
Type_of_mutation | Substitution | g | a | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00026553 | |||||||
Laboratory | MJ | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00009507 | ||||||
Transcript | F37D6.1.1 (12) | |||||||
Genetics | Interpolated_map_position | I | 5.05256 | |||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00046507 | ||||
Person_evidence | WBPerson205 | |||||||
Curator_confirmed | WBPerson712 | |||||||
WBPerson557 | ||||||||
Remark | Mutations in emb-10, zyg-2 and mus-101 all fail to complement each other. | Person_evidence | WBPerson205 | |||||
Curator_confirmed | WBPerson712 | |||||||
Embryonic lethal phenotype apparent at 24C and not at 15C. | Paper_evidence | WBPaper00046507 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Penetrance | Complete | Person_evidence | WBPerson205 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Person_evidence | WBPerson205 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive (2) | |||||||
Phenotype_assay | Strain | WBStrain00026553 | Person_evidence | WBPerson205 | ||||
Curator_confirmed | WBPerson712 | |||||||
Temperature | 24 | Paper_evidence | WBPaper00046507 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | viable at 16C | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | sterile | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature sensitive sterile. Maintain at 15C. | Curator_confirmed | WBPerson712 | ||||||
Laboratory_evidence | MJ | |||||||
Temperature_sensitive | Heat_sensitive | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Strain | WBStrain00026553 | Curator_confirmed | WBPerson712 | ||||
Reference (4) | ||||||||
Method | Substitution_allele |