WormBase Tree Display for Variation: WBVar00088208
expand all nodes | collapse all nodes | view schema
WBVar00088208 | Evidence | Paper_evidence | WBPaper00004897 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | k149 | |||||||
Other_name | CE20409:p.Arg45Ter | ||||||||
Y106G6E.5a.1:c.112C>T | |||||||||
Y106G6E.5b.1:c.133C>T | |||||||||
CE27228:p.Arg38Ter | |||||||||
HGVSg | CHROMOSOME_I:g.10226272G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y106G6E | |||||
Flanking_sequences | attgacaaagaatttacaatatggaatcat | gagctgtaattccatcaaatgctcttcaca | |||||||
Mapping_target | Y106G6E | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00028699 | ||||||||
Laboratory | MJ | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000426 | |||||||
Transcript | Y106G6E.5a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y106G6E.5a.1:c.112C>T | ||||||||
HGVSp | CE27228:p.Arg38Ter | ||||||||
cDNA_position | 112 | ||||||||
CDS_position | 112 | ||||||||
Protein_position | 38 | ||||||||
Exon_number | 2/9 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
Y106G6E.5b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y106G6E.5b.1:c.133C>T | ||||||||
HGVSp | CE20409:p.Arg45Ter | ||||||||
cDNA_position | 149 | ||||||||
CDS_position | 133 | ||||||||
Protein_position | 45 | ||||||||
Exon_number | 3/9 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
Interactor | WBInteraction000517324 | ||||||||
WBInteraction000517325 | |||||||||
WBInteraction000517347 | |||||||||
WBInteraction000517348 | |||||||||
Genetics | Interpolated_map_position | I | 4.76162 | ||||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00004897 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Partially penetrant embryonic lethality | Paper_evidence | WBPaper00004897 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004897 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000188 | Paper_evidence | WBPaper00004897 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Gonad arms are misshapened | Paper_evidence | WBPaper00004897 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004897 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000195 | Paper_evidence | WBPaper00004897 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Migration of the distal tip cells was frequently misdirected | Paper_evidence | WBPaper00004897 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004897 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006865 | PATO:0000460 | Paper_evidence | WBPaper00004897 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000243 | Paper_evidence | WBPaper00031805 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No enrichment of DYN-1 adjacent to the apoptotic cell in mutant worms deficient for corpse internalization, suggesting that DYN-1 is recruited at a stage following corpse recognition and internalization | Paper_evidence | WBPaper00031805 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000885 | Paper_evidence | WBPaper00004897 | |||||||
WBPaper00038317 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | Mutants are deficient in the removal of apoptotic cell corpses | Paper_evidence | WBPaper00004897 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Persistent cell corpses accumulate. | Paper_evidence | WBPaper00038317 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004897 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000047 | Paper_evidence | WBPaper00040757 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 0/4 gastrulation defect/total embryos | Paper_evidence | WBPaper00040757 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00038317 | ||||||||
WBPaper00040757 | |||||||||
WBPaper00031805 | |||||||||
WBPaper00032446 | |||||||||
WBPaper00004897 | |||||||||
Method | Substitution_allele |