WormBase Tree Display for Variation: WBVar00088209
expand all nodes | collapse all nodes | view schema
WBVar00088209 | Evidence | Paper_evidence | WBPaper00004897 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | k156 | |||||||
Other_name | CE20409:p.Trp202Ter | ||||||||
Y106G6E.5a.1:c.584delinsA | |||||||||
Y106G6E.5b.1:c.605delinsA | |||||||||
CE27228:p.Trp195Ter | |||||||||
HGVSg | CHROMOSOME_I:g.10225462delinsT | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y106G6E | |||||
Flanking_sequences | tgctggaattagctgtaggagattttacat | aaatcagtaccaaatgatgtagttgtgtct | |||||||
Mapping_target | Y106G6E | ||||||||
Type_of_mutation | Substitution | gg | rr | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | MJ | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000426 | |||||||
Transcript | Y106G6E.5a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y106G6E.5a.1:c.584delinsA | ||||||||
HGVSp | CE27228:p.Trp195Ter | ||||||||
cDNA_position | 584-585 | ||||||||
CDS_position | 584-585 | ||||||||
Protein_position | 195 | ||||||||
Exon_number | 3/9 | ||||||||
Codon_change | tGG/tAG | ||||||||
Amino_acid_change | W/* | ||||||||
Y106G6E.5b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y106G6E.5b.1:c.605delinsA | ||||||||
HGVSp | CE20409:p.Trp202Ter | ||||||||
cDNA_position | 621-622 | ||||||||
CDS_position | 605-606 | ||||||||
Protein_position | 202 | ||||||||
Exon_number | 4/9 | ||||||||
Codon_change | tGG/tAG | ||||||||
Amino_acid_change | W/* | ||||||||
Genetics | Interpolated_map_position | I | 4.75927 | ||||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00004897 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Partially penetrant embryonic lethality | Paper_evidence | WBPaper00004897 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004897 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000188 | Paper_evidence | WBPaper00004897 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Gonad arms are misshapened | Paper_evidence | WBPaper00004897 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004897 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000195 | Paper_evidence | WBPaper00004897 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Migration of the distal tip cells was frequently misdirected | Paper_evidence | WBPaper00004897 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004897 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006865 | PATO:0000460 | Paper_evidence | WBPaper00004897 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000885 | Paper_evidence | WBPaper00004897 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants are deficient in the removal of apoptotic cell corpses | Paper_evidence | WBPaper00004897 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004897 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00004897 | ||||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00000426 Amber_UAG_or_Opal_UGA W(195) to stop | Paper_evidence | WBPaper00004897 | ||||||
Method | Substitution_allele |