WormBase Tree Display for Variation: WBVar00088248
expand all nodes | collapse all nodes | view schema
WBVar00088248 | Evidence | Person_evidence | WBPerson1068 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | km17 | |||||||
Other_name | T27C10.6.1:c.5034_6388-141del | ||||||||
HGVSg | CHROMOSOME_I:g.10881138_10883054del | ||||||||
Sequence_details | SMap | S_parent | Sequence | T27C10 | |||||
Flanking_sequences | ttctccatcgatactttgaaataaaatttt | gtatccggtgcaagttctctcatatgaaga | |||||||
Mapping_target | T27C10 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | KU | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003068 | |||||||
WBGene00020858 | |||||||||
Transcript | T27C10.3.1 | VEP_consequence | splice_donor_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
Intron_number | 1/8 | ||||||||
Exon_number | 1/9 | ||||||||
T27C10.6.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T27C10.6.1:c.5034_6388-141del | ||||||||
cDNA_position | 5046-? | ||||||||
CDS_position | 5034-? | ||||||||
Protein_position | 1678-? | ||||||||
Intron_number | 17-18/21 | ||||||||
Exon_number | 17-18/22 | ||||||||
Interactor | WBInteraction000502836 | ||||||||
WBInteraction000502839 | |||||||||
WBInteraction000541608 | |||||||||
WBInteraction000541724 | |||||||||
Genetics | Interpolated_map_position | I | 5.56337 | ||||||
Mapping_data | In_multi_point | 4480 | |||||||
Description | Phenotype | WBPhenotype:0000436 | Paper_evidence | WBPaper00029175 | |||||
Curator_confirmed | WBPerson1068 | ||||||||
Remark | synaptic vesicle (SV) proteins are mislocalized to both presynaptic and dendritic endings in neurons. | Paper_evidence | WBPaper00029175 | ||||||
Curator_confirmed | WBPerson1068 | ||||||||
EQ_annotations | GO_term | GO:0030425 | PATO:0000460 | Paper_evidence | WBPaper00029175 | ||||
Curator_confirmed | WBPerson1068 | ||||||||
WBPhenotype:0000459 | Paper_evidence | WBPaper00034758 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The lrk-1 [km17] strain showed enhanced vulnerability to rotenone. lrk-1 [km17]/DAT::GFP showed enhanced loss of DAT::GFP fluorescence in response to rotenone treatment compared with control | Paper_evidence | WBPaper00034758 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00034758 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002069 | Paper_evidence | WBPaper00049878 | |||||||
Curator_confirmed | WBPerson8620 | ||||||||
Remark | Less than 20% of animals exhibit overextension of ALM axons | Paper_evidence | WBPaper00049878 | ||||||
Curator_confirmed | WBPerson8620 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005406 | PATO:0000460 | Paper_evidence | WBPaper00049878 | ||||
Curator_confirmed | WBPerson8620 | ||||||||
GO_term | GO:0030424 | PATO:0000460 | Paper_evidence | WBPaper00049878 | |||||
Curator_confirmed | WBPerson8620 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00049878 | ||||||
Curator_confirmed | WBPerson8620 | ||||||||
Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00034758 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The km17 deletion exerted no affect on baseline viability | Paper_evidence | WBPaper00034758 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00034758 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00040857 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No mislocalization defects were observed of SNB-1 in the RIA neuron of lrk-1(km17) mutants. | Paper_evidence | WBPaper00040857 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00034758 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | In the lrk-1 [km17] strain, SNB expression is mislocalized at the dendritic tip of the amphid sensory neuron | Paper_evidence | WBPaper00034758 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00034758 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0004028 | Paper_evidence | WBPaper00036154 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibit a basal slowing response in response to food, characteristic of control worms. | Paper_evidence | WBPaper00036154 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Disease_info | Models_disease | DOID:14330 | |||||||
Models_disease_in_annotation | WBDOannot00000473 | ||||||||
Reference | WBPaper00040857 | ||||||||
WBPaper00029175 | |||||||||
WBPaper00034758 | |||||||||
WBPaper00036154 | |||||||||
WBPaper00010007 | |||||||||
WBPaper00049878 | |||||||||
Method | Deletion_allele |