WormBase Tree Display for Variation: WBVar00088252
expand all nodes | collapse all nodes | view schema
WBVar00088252 | Evidence | Person_evidence | WBPerson1068 | ||
---|---|---|---|---|---|
Name | Public_name | km25 | |||
Other_name | ku25 | Paper_evidence | WBPaper00048491 | ||
HGVSg | CHROMOSOME_IV:g.8148733_8149107del | ||||
Sequence_details | SMap | S_parent | Sequence | B0218 | |
Flanking_sequences | tttatatttacatttatattggttttacgt | cgttgtatgtgtcatgaaaatataattgat | |||
Mapping_target | B0218 | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00000323 | ||||
WBStrain00024040 | |||||
WBStrain00040805 | |||||
WBStrain00040811 | |||||
WBStrain00052464 | |||||
Laboratory | KU | ||||
Status | Live | ||||
Affects | Gene | WBGene00004055 | |||
Transcript | B0218.3.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||
VEP_impact | HIGH | ||||
cDNA_position | ?-270 | ||||
CDS_position | ?-258 | ||||
Protein_position | ?-86 | ||||
Intron_number | 2/5 | ||||
Exon_number | 1-3/6 | ||||
Interactor (27) | |||||
Isolation | Mutagen | TMP/UV | Person_evidence | WBPerson1068 | |
Genetics | Interpolated_map_position | IV | 3.64217 | ||
Description | Phenotype (36) | ||||
Phenotype_not_observed (12) | |||||
Reference (38) | |||||
Remark | ku25 incorrectly cited as km25. KU25 is the strain carrying km25 | Paper_evidence | WBPaper00048491 | ||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||
Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||
Method | Deletion_allele |