WormBase Tree Display for Variation: WBVar00088276
expand all nodes | collapse all nodes | view schema
WBVar00088276 | Evidence | Paper_evidence | WBPaper00004727 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ks5 | |||||||
Other_name | C40H5.5b.1:c.516+1G>A | ||||||||
C40H5.5a.1:c.600+1G>A | |||||||||
HGVSg | CHROMOSOME_X:g.11766925C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | C40H5 | |||||
Flanking_sequences | atttttcatcatgcgtgtttcgtatgtttt | tgagtttttaacaattttaaacaaattgtt | |||||||
Mapping_target | C40H5 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00007506 | ||||||||
WBStrain00052442 | |||||||||
Laboratory | FK | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006654 | |||||||
Transcript | C40H5.5b.1 | VEP_consequence | splice_donor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C40H5.5b.1:c.516+1G>A | ||||||||
Intron_number | 4/8 | ||||||||
C40H5.5a.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C40H5.5a.1:c.600+1G>A | ||||||||
Intron_number | 5/10 | ||||||||
Interactor | WBInteraction000003413 | ||||||||
WBInteraction000003414 | |||||||||
WBInteraction000003415 | |||||||||
WBInteraction000003416 | |||||||||
WBInteraction000503643 | |||||||||
WBInteraction000521604 | |||||||||
WBInteraction000554842 | |||||||||
WBInteraction000554843 | |||||||||
WBInteraction000554844 | |||||||||
WBInteraction000569170 | |||||||||
Genetics | Interpolated_map_position | X | 6.71664 | ||||||
Description | Phenotype | WBPhenotype:0000997 | Paper_evidence | WBPaper00035614 | |||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed (2) | |||||||||
Remark (2) | |||||||||
WBPhenotype:0001090 | Paper_evidence | WBPaper00031874 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants are less viable than wild-type animals under conditions of heat stress. Reduced thermotolerance in these mutants is not due to a decline in hsf-1 levels | Paper_evidence | WBPaper00031874 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031874 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Animals were exposed to a transient increase in temperature (30C or 34C for 15 min), and their heat shock response was measured as the total amount of hsp70 (C12C8.1) mRNA, 2 hours after heat shock | Paper_evidence | WBPaper00031874 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001273 | Paper_evidence | WBPaper00031874 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutations affecting the AFD or AIY neurons reduced heat shock-dependent accumulation of hsp70 (C12C8.1) mRNA at 30C and 34C | Paper_evidence | WBPaper00031874 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031874 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Animals were exposed to a transient increase in temperature (30C or 34C for 15 min), and their heat shock response was measured as the total amount of hsp70 (C12C8.1) mRNA, 2 hours after heat shock | Paper_evidence | WBPaper00031874 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00031874 | |||||||
WBPaper00004727 | |||||||||
Curator_confirmed (2) | |||||||||
Remark (2) | |||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031874 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Animals were exposed to a transient increase in temperature (30C or 34C for 15 min), and their heat shock response was measured as the total amount of hsp70 (C12C8.1) mRNA, 2 hours after heat shock | Paper_evidence | WBPaper00031874 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Genotype | C12C8.1p::gfp | Paper_evidence | WBPaper00031874 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
ttx-3prom::gfp (mgIs18) | Paper_evidence | WBPaper00004727 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001639 | Paper_evidence | WBPaper00035327 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | ttx-3(AIY) mutants roamed twice less than wild type worms on food | Paper_evidence | WBPaper00035327 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002199 | Paper_evidence | WBPaper00049050 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "In addition, ttx-3 mutants, which are defective in AIY function (Hobert et al., 1997), did not show the temperature-evoked suppression of RIA activity (Figure 5B)." | Paper_evidence | WBPaper00049050 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006833 | PATO:0000460 | Paper_evidence | WBPaper00049050 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | njIs30[glr-3p::GCaMP3, glr-3p::TagRFP, ges-1p::nls-TagRFP] (V); Parent strain: IK1565 | Paper_evidence | WBPaper00049050 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002513 | Paper_evidence | WBPaper00004727 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Thermotaxis defects mimic those seen upon laser ablation of the AIY interneurons. | Paper_evidence | WBPaper00004727 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Phenotype_not_observed | WBPhenotype:0000637 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No obvious abnormalities in dauer formation. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000648 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No obvious abnormalities in male mating. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000663 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No obvious abnormalities in osmotic avoidance. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001462 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No obvious abnormalities in chemotaxis to NaCl. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001661 | Paper_evidence | WBPaper00003760 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Asymmetric expression in AWC was normal | Paper_evidence | WBPaper00003760 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference (16) | |||||||||
Remark | ks5 is mutated at the splice donor site at exon 5 (G->A) [030414 ck1] | ||||||||
Method | Substitution_allele |