WormBase Tree Display for Variation: WBVar00088288

WBVar00088288 Name: Public_name: ks54
    HGVSg: CHROMOSOME_X:g.7478047_7480221delinsAGAGTGGCTATA
  Sequence_details: SMap: S_parent: Sequence: K08A8
    Flanking_sequences: TAAAAAAAAATAGTTTTTATTTATTTGATT CGGAACCGAATTCGACATGATGTCCAAGAT
    Mapping_target: K08A8
    Type_of_mutation: Insertion: GAGAGTGGCTATA
      Deletion
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00007509
    Laboratory: FK
    Status: Live
  Affects: Gene: WBGene00003185
      WBGene00196302
      WBGene00195330
    Transcript: K08A8.4 VEP_consequence: transcript_ablation
        VEP_impact: HIGH
        Exon_number: 1/1
      K08A8.8 VEP_consequence: transcript_ablation
        VEP_impact: HIGH
        Exon_number: 1/1
      K08A8.1a.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-820
        CDS_position: ?-812
        Protein_position: ?-271
        Intron_number: 2-4/6
        Exon_number: 1-5/7
    Interactor (14)
  Genetics: Interpolated_map_position: X -1.6735
    Mapping_data: In_multi_point: 4486
  Description: Phenotype (11)
    Phenotype_not_observed (11)
  Disease_info: Modifies_disease: DOID:14330
    Modifies_disease_in_annotation: WBDOannot00000645
  Reference (16)
  Remark: In addition to the lesion curated, ks54 has an additional deletion and insertion alteration. The flanking sequences of this lesion are AAACAGTACACAACTAGTATTTATGTATTT & GGCCAAATTCTCTCCGGACTTCTGTCAACT and the inserted sequence is ATGCACGACAAACGGATGCTGGAGGAGCATATCGTAATTGGGACGCATCGTTGGATCAC. The alternation is an inverted copy of sequence from the middle of the final exon inserted just before the final exon. Person_evidence: WBPerson508
  Method: Deletion_and_insertion_allele